Labshake search
Citations for Lucigen :
2301 - 2345 of 2345 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... cloni®10G ELITE electrocompetent cells (Lucigen). All libraries at this step yielded greater than 5,000,000 colonies corresponding to greater than 20× coverage.
-
bioRxiv - Genomics 2020Quote: ... we extracted genomic DNA using Master Pure genomic DNA extraction Kit (Epicentre) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Dual extraction of nucleic acid (RNA and DNA) from each pupa was carried out using the MasterPure dual extraction kit (Epicentre, MC85200). Briefly ...
-
bioRxiv - Genomics 2020Quote: The gDNA used in this study was extracted with the MasterPure™ DNA Purification Kit (Epicentre, USA) following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2020Quote: ... coli cells of strain C41(DE3) (Lucigen) were transformed with the KR2 expression plasmid ...
-
bioRxiv - Immunology 2020Quote: ... bisulfite-modified DNA sequencing libraries were generated using the EpiGenome kit (Epicentre) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... The bisulfite-modified DNA-sequencing library was generated using the EpiGnome™ kit (Epicentre) per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... coli (Lucigen, Cat# 60502-2) over fifty shocks for each library ...
-
bioRxiv - Microbiology 2020Quote: ... coli strain C41(DE3)(Lucigen). Bacteria were grown at 37°C to an OD600nm of 0,9 ...
-
bioRxiv - Microbiology 2020Quote: ... first we modified the pSMART-BAC v2.0 (Lucigen) to get ride of unwanted restriction enzymes and added AatII and XhoI sites to facilitate cloning by multiple rounds of fusion-PCR mediated mutagenesis ...
-
bioRxiv - Microbiology 2020Quote: ... BAC plasmid was delivered into BAC-Optimized Replicator v2.0 Electrocompetent Cells (Lucigen) by electroporation and bacteria was propagated according to the manufacturer’s guide ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was directly treated with Baseline-ZERO DNase (2.5 units/50 μL; Epicentre) for 30 min at 37°C (all the RNA) ...
-
bioRxiv - Microbiology 2020Quote: ... rRNA depletion for the mRNA library was conducted with Ribozero kit (Epicentre) with the low input protocol ...
-
bioRxiv - Microbiology 2020Quote: ... were collected by swabbing the inner pinna of the ear of two dogs using Sterile Catch-All™ Sample Collection Swabs (Epicentre Biotechnologies). DNA was extracted with QIAGEN-DNeasy PowerSoil Kit ...
-
bioRxiv - Microbiology 2020Quote: ... Double stranded cDNA synthesis was performed with rRNA-depleted mRNA using ScriptSeq™ v2 RNA-Seq Library Preparation guide (EpiCentre Inc., Madison, WI, USA) in accordance with the manufacturer’s standard protocol ...
-
bioRxiv - Microbiology 2020Quote: ... total RNA was subjected to rRNA-depletion using RiboZero™ rRNA Removal Kit (EpiCentre Inc., Madison, WI, USA). Double stranded cDNA synthesis was performed with rRNA-depleted mRNA using ScriptSeq™ v2 RNA-Seq Library Preparation guide (EpiCentre Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... rRNAs and other uncapped RNA species were depleted from RNA samples using the Terminator™ 5’-Phosphate-Dependent Exonuclease (Lucigen). Following a standard phenol-chloroform-isoamyl precipitation ...
-
bioRxiv - Microbiology 2020Quote: Samples were analyzed directly or mixed 1:1 with one of the following buffers: Quick Extract DNA Extraction Solution (Lucigen), Virotype Tissue Lysis Reagent (INDICAL BIOSCIENCE GmbH ...
-
bioRxiv - Plant Biology 2020Quote: ... Ribo-Zero kit (Epicentre, an Illumina company, Madison, WI) was used to remove rRNA from the libraries ...
-
bioRxiv - Microbiology 2020Quote: A Salmonella transposon mutant library containing circa 100,000 mutants was generated using EZ-Tn5 transposase (Epicentre) and the aphA1 kanamycin resistance gene as described previously (Langridge et al. ...
-
bioRxiv - Microbiology 2020Quote: ... 67.5U Ready-Lyse lysozyme (Epicentre), 10U/mL DNase I ...
-
bioRxiv - Microbiology 2020Quote: ... Any remaining DNA was degraded via Baseline-ZERO-DNase (Epicentre) using manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... using the MasterPure™ Gram Positive DNA Purification Kit (Epicentre, Madison, WI, USA), for PacBio sequencing ...
-
bioRxiv - Genomics 2020Quote: ... and then lysed in 100 μl QuickExtract™ Buffer (Lucigen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase H (10U; Lucigen, H39500) was added and the mixture incubated at 45°C for 30 min in 20 μl containing 50 mM Tris-HCl (pH 7.4) ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-deadenylase (Epicentre) was used to deadenylate the pre-adenylated linkers ...
-
bioRxiv - Molecular Biology 2020Quote: ... Truncated cDNAs (120-170nt) were size selected from denaturing polyacrylamide gels and gel purified cDNAs were circularized with CircLigase ssDNA ligase (Epicentre). Circularized cDNAs were PCR amplified with forward primer (AATGATACGGCGACCACCGA ...
-
bioRxiv - Immunology 2020Quote: ... and resuspended in 50 µL QuickExtract DNA extraction solution (LuciGen, Middleton, WI). The suspensions were transferred to 96-well PCR plates and incubated at 65 °C for 20 min and then at 98 °C for 5 min using a thermocycler ...
-
bioRxiv - Immunology 2020Quote: ... genomic DNA was isolated from selected monoclonal cell lines using QuickExtract DNA Extraction Solution (Epicentre). To test for gene editing and positional insertion of mGFP/mScarlet-I cassette ...
-
bioRxiv - Immunology 2020Quote: ... genomic DNA was isolated from selected monoclonal cell lines using QuickExtract DNA Extraction Solution (Epicentre). Primers specific to the blasticidin resistance cassette and IRAK1/IRAK4 gene loci were used to verify the insertion (see Table S5 and S6 for IRAK4 and IRAK1 respectively) ...
-
bioRxiv - Immunology 2020Quote: ... We digested the DNA with Quickextract (Lucigen Corporation) at 68°C for 90 minutes ...
-
bioRxiv - Immunology 2020Quote: ... DNA was isolated from the clones using the QuickExtract DNA Extraction Solution (Lucigen, Middleton, USA). Upon amplification and sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from pure colonies using the MasterPure™Yeast DNA Purification Kit (Epicentre, Madison, WI) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... coli SS320 electrocompetent cells (F’[proAB lacIqZ ΔM15 Tn10 (TetR)] araD139 Δ(ara-leu)7696 galE15 galK16 Δ(lac)X74 rpsL (StrR) hsdR2 (rK– mK+) mcrA mcrB1) were purchased from Lucigen Corporation and used as the host for phage library production.
-
bioRxiv - Genetics 2020Quote: ... Total DNA and/or RNA was extracted using QuickExtract DNA (Epicentre, Cat# QE09050) or QuickExtract RNA (Epicentre ...
-
bioRxiv - Genetics 2020Quote: ... or QuickExtract RNA (Epicentre, Cat# QER090150), respectively ...
-
bioRxiv - Genomics 2020Quote: ... gDNA was directly isolated from conidia stocks using the MasterPure(tm) Yeast DNA Purification Kit (Lucigen/Epicentre) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... gDNA was directly isolated from conidia stocks using the MasterPure(tm) Yeast DNA Purification Kit (Lucigen/Epicentre) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... DNA was extracted using MasterPure Complete DNA & RNA Purification Kits (Lucigen Simplifying Genomics, USA) according to the manufacturer’s protocol and diluted to 50 ng/μL.
-
bioRxiv - Genetics 2020Quote: ... Total RNA was extracted using a MasterPure™ Yeast RNA Purification Kit (Lucigen MPY03100), the RNA concentration was determined on a Nanodrop 2000C (Thermo Scientific) ...
-
bioRxiv - Genetics 2020Quote: DNA was isolated from each of the four cell pools with 100 µL QuickExtract (Lucigen) per 1 million cells following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... complementary tandem repeats were generated through rolling-circle amplification (RCA) with NxGen® phi29 DNA Polymerase (Lucigen, 30221). The single-stranded amplicons were detected with a Cy5-labeled oligonucleotide (Cy5-DP5 ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were resuspended and lysed by 120 kU Ready-Lyse lysozyme (Lucigen), 400 U RNase I (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: The resulting cDNA was circularized by 40 U ssDNA ligase (Lucigen) at 60 °C for 4 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... Comparable results to commercial RNA extraction kits have been obtained using a 5-min direct detection preparation method of nasopharyngeal samples following 1:1 dilution with the Quick Extract DNA extraction Solution (Lucigen) (6) ...