Labshake search
Citations for Thermo Fisher :
9901 - 9950 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... cells were released from the Matrigel by incubating with 50 μL of dispase (5 mg/mL) (Life Technologies #17105-041) at 37°C for 45 min ...
-
bioRxiv - Cell Biology 2022Quote: All cell lines were cultured at 37°C in 5% CO2 atmosphere in Dulbeccós modified medium (DMEM, Gibco TM, Thermofisher) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... ATCC® CCL-2) were grown at 37 °C under 5% CO2 in DMEM high glucose glutamax (Gibco, 61965-059) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... All samples were boiled for 5 min prior to separation by SDS PAGE on precast 3-8% Tris-Acetate NuPAGE gels (Invitrogen). SDS-PAGE fractionated proteins were transferred to a nitrocellulose membrane using a semidry Trans-Blot Turbo Transfer System (Bio-rad) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were routinely cultured at 37°C and 5 % CO2 in a humidified incubator in DMEM supplemented with 10 % FBS (both from Gibco). Antibiotics were only added for selection or maintenance of stable cell lines.
-
bioRxiv - Developmental Biology 2022Quote: Embryos/tadpoles were either injected intra-abdominally (at stage < 41) or bathed (at later stages) with/in a 1 mM 5-ethynyl-20-deoxyuridine solution (EdU, Invitrogen). They were then fixed after the desired time-period in 4% paraformaldehyde ...
-
bioRxiv - Genomics 2022Quote: ... The 5637 and RT112/84 were incubated in a humidified constant 37C and 5% CO2 incubator in RPMI-1640 (Gibco) and EMEM (ATCC ...
-
bioRxiv - Immunology 2022Quote: ... Cryoblocks were cut at a thickness of 12-14 µm and then blocked with PBS 1X containing 5% normal goat or donkey serum (Invitrogen); 0.2% BSA(w/v) ...
-
bioRxiv - Immunology 2022Quote: ... The following day plates were washed 5 times with 200 µL/well of PBS containing 0.05 % Tween20 (Thermo Fisher Scientific). To each well 50 µL of 2 µg/mL of biotin-conjugated mouse anti-bovine IFN-γ mAb (CC302 ...
-
bioRxiv - Genetics 2022Quote: ... Expression levels of genes was quantified using qRT-PCR and the QuantStudio™5 Real-Time PCR system (Thermo Fisher). qRT-PCR was performed using the indicated qPCR primers (Supplementary Table 11) ...
-
bioRxiv - Immunology 2022Quote: ... The immunoprecipitated ALPK1 was released by incubation for 5 min at 95 °C with LDS sample buffer (Thermo Fisher, #NP0007) containing 2.5% (v/v ...
-
bioRxiv - Genetics 2022Quote: ... The next day the coverslips were rinsed in a Coplin jar with deionized formamide (5 ml) combined with 4x SSC (Invitrogen) for 20 minutes at 37 °C ...
-
bioRxiv - Genetics 2022Quote: ... Membranes were blocked with 5% nonfat milk and probed with mouse anti-FLAG (MA1-91878; Invitrogen; 1:1000; RRID AB_1957945), rabbit anti-GFP (NB600-308 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... cells were split with EDTA at 1:5 ratios in culture dishes coated with matrigel and culture in N2B27 medium (comprised of DMEM/F12 medium (Invitrogen) supplemented with 1% MEM-nonessential amino acids (Invitrogen) ...
-
bioRxiv - Genomics 2022Quote: ZIP13K2-derived EN cells (5 x 106 /IP) were harvested and cross-linked in 1% formaldehyde (Thermo Fisher Scientific, 28908) in DPBS for 10 min at RT ...
-
bioRxiv - Immunology 2022Quote: ... 5-7 × 106 cells were resuspended in 3 mL of FACS buffer (4% FBS in phosphate buffered saline (PBS, Gibco)) and sorted at the University of Massachusetts Amherst Flow Cytometry Core Facility using a BD FACSAria Fusion (Becton Dickinson) ...
-
bioRxiv - Plant Biology 2022Quote: ... Samples were purified on the semipreparative LC using 200 µL injections at a flow rate of 1.5 mL/minute using a C18 semipreparative column at 30 °C (Acclaim C18 5 µm 120 Å, 4.6 x 150 mm, ThermoFisher). Solvents A and B were ...
-
bioRxiv - Synthetic Biology 2022Quote: ... supplemented with 5% HyClone fetal bovine serum (FBS) (Cytiva Life Sciences, #SH30084.03, AU origin) and 10% tryptose phosphate broth (TPB) (ThermoFisher, #CM0283B), referred to as BHK-21 Growth Medium ...
-
bioRxiv - Microbiology 2022Quote: Qualitative detection of hemolysis activity was performed using BHI agar plates supplemented with 5% (v/v) horse blood (Fisher Scientific). 10 μL of overnight culture were spotted on blood plates and incubated at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... and the vesicular stomatitis virus G (VSV-G)-expressing plasmid at a ratio of 7:7:1 (5 μg total amount of DNA) using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: Blood virus mixtures were titrated by ten-fold serial dilution in virus media (RPMI 1640 cell culture media supplemented with 5% fetal bovine serum [FBS] and 1% Penicillin-Streptomycin [Gibco]) in a 96-well plate before transferring dilutions to equivalent wells of a 96 well plate containing near confluent C6/36 cell monolayers ...
-
bioRxiv - Microbiology 2022Quote: ... LN cryosections were cut in triplicate at 5 μm using a Microm HM 550 cryostat (Thermo Fisher Scientific, Waltham, MA). Sections attached to slides were fixed with cold acetone/ethanol (1:1 ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was washed three times with PBS + 0.05% Tween-20 and then incubated for 5 min with Pierce ECL Plus substrate (Thermo Scientific). Chemiluminescence was detected using an ImageQuant LAS 4000 imager ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 μL RNA + 95 μL H2O) into a new RNA dilution plate (96-well PCR quality plate – Thermo Scientific #AB0900). The final in-well concentration of the diluted RNA was in the range of 0.2 to 5 ng/μL.
-
bioRxiv - Neuroscience 2022Quote: ... the 376-bp amplicon containing Drd2-exon5 and introns/exon 5 junctions from several F0 and F1 mice were cloned into TOPO-TA Cloning vector (Invitrogen by Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2022Quote: ... The ventricles were dissected into 3-mm2 columns and shaken at 800 rpm for 90–120 min at 30°C with 750 µL digestion buffer (12.5 µM CaCl2, 5 mg/mL collagenase type II [Thermo Fisher Scientific Inc. ...
-
bioRxiv - Physiology 2022Quote: ... R:3’-UUGAACGUCACUAUAUUAACUGUUGUA-5’) dicer-substrate siRNA (DsiRNA) (20 nM, Integrated DNA Technologies, Coralville, IA) using Lipofectamine 3000 transfection reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Real-time PCR was performed with a 1:5 dilution of cDNA using QuantStudio3 real-time PCR apparatus (Life Technologies) and TaqMan® reagents with predesigned assays for the target genes GAD65 (alias GAD2 ...
-
bioRxiv - Neuroscience 2022Quote: ... Brain sections were incubated in blocking solution (0.2% Triton X-100 in PBS with 5% normal goat serum) for 1 hr at 4°C and then with a primary antibody anti-GFP (Invitrogen, catalog # G10362 ...
-
bioRxiv - Microbiology 2022Quote: ... A pellet was obtained using a short spin (250 × g for 5 min) and was resuspended in serum-free RPMI 1640 medium (Gibco) containing antibiotics (Pen/Strep ...
-
bioRxiv - Microbiology 2022Quote: ... HFFs were collected via centrifugation at 600 RPM for 5 minutes and resuspended to a concentration of 1.1×107 in resuspension buffer R (ThermoFisher #MPK1025). In a separate tube ...
-
bioRxiv - Immunology 2022Quote: ... and cells were incubated at 37°C in 5% CO2 and 100% humidity in RPMI-1640 supplemented with 10% FBS and 100ug/ml penicillin/streptopmycin (Gibco).
-
bioRxiv - Synthetic Biology 2022Quote: ... Conjugation of the dye to the polymer was achieved by adding 5 mg of the amine-reactive Pacific Blue succinimidyl ester (ThermoFisher) to a solution of 20 mg AD (Fina Biosolutions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 5 μl of the Phire PCR reaction was verified on a 1% agarose gel (Ultra-Pure agarose, # 16500-500, Invitrogen), with a 1kb bench top ladder (G754A ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
Allelic diversity uncovers protein domains contributing to the emergence of antimicrobial resistancebioRxiv - Microbiology 2022Quote: ... Samples were diluted 1:5 in sample loading buffer and quantified using the Pierce BCA Protein Assay Kit (Thermo Scientific). Lysates were normalized to 100μg/mL in 1X Bolt™ LDS Sample Buffer (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... 1.0 µl BSA (20 mg/ml) and 0.2 µl AmpliTaq Gold polymerase (5 U/µl, Applied Biosystems, Thermo Fisher Scientific). Negative PCR controls were included.
-
bioRxiv - Microbiology 2022Quote: ... 1.0 µl BSA (20 mg/ml) and 0.2 µl AmpliTaq Gold polymerase (5 U/µl, Applied Biosystems, Thermo Fisher Scientific). Negative PCR controls were included.
-
bioRxiv - Microbiology 2022Quote: ... Plates were incubated at 37° C and 5% CO2 with 50% L-WRN conditioned media (CM) and 50% primary culture medium (Advanced DMEM/F12, Invitrogen) supplemented with 20% FBS ...
-
bioRxiv - Microbiology 2022Quote: ... Staphylococcus aureus (ATCC 29213) and Escherichia coli (ATCC 25922) were passaged twice on tryptic soy agar with 5% sheep’s blood (Thermo Scientific) at 37° C in 5% CO2 for 18-24 hours ...
-
bioRxiv - Microbiology 2022Quote: ... The RNA was precipitated with ice-cold isopropanol and 3 M sodium acetate (pH 5) at 4°C before RNA pellets were suspended in nuclease-free H2O and treated with DNase I (Ambion) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were then transferred to a temperature-controlled chamber (37ºC and 5% CO2) and imaged in FluoroBrite medium (Life Technologies) supplied with 5% FCS ...
-
bioRxiv - Microbiology 2022Quote: ... and then loaded onto a PepMap C18 trap column (100 μm x 2 cm, 5 μm particle size, Thermo Scientific) followed by separation on an in-house packed column (75 mm x 19 cm ...
-
bioRxiv - Microbiology 2022Quote: ... Lysates were centrifuged (13,000 × g for 5 min at 4°C) and supernatants are precleared with 10 μl protein G beads (Invitrogen; 1004D) at 4°C for 1 h ...
-
bioRxiv - Microbiology 2022Quote: Cells used in this study were purchased as authenticated cell lines (STR profiling) from ATCC and cultured under standard conditions (37 °C, 5% CO2) using DMEM (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were then blocked with 5% FBS in PBS for 20 min before stained with Alexa Flour 594 phalloidin (1:100, Invitrogen) for 1 h and 10 μg/ml DAPI (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Surface PCDH1 was stained using human anti-EC7 mAb-3677 (5 µg/mL) followed by anti-human Alexa FluorTM 555 (ThermoFisher) for 1 h at 4°C each ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were centrifuged at 300 g for 5 min and resuspended in 30 µL of 75 nM LysoTracker green (#L7526, ThermoFisher). Samples were analysed using Amnis ImageStreamX Mk II imaging flow cytometer (Luminex).
-
bioRxiv - Plant Biology 2022Quote: ... The sections were then cleared and stained in Clearsee solution with Basic Fuchsin (Fisher scientific Cat no 632-99-5) for 30 minutes followed by two washing steps in Clearsee only ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were permeabilized for 5 min with 0.5% Triton-X-100 (Fisher Chemical - Thermo Fisher, T/3751/08, Waltham, Massachusetts), followed by 30 min incubation with 2% normal goat serum (NGS ...