Labshake search
Citations for Thermo Fisher :
9501 - 9550 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... proteins were transferred onto a nitrocellulose membrane and then blocked overnight while shaken at 4 °C in TBST-5% BSA—a TBS Tween-20 (TBST; ThermoFisher) solution containing 5% bovine serum albumin (BSA ...
-
bioRxiv - Neuroscience 2021Quote: ... Brains were extracted from rats aged postnatal day 5-7 and placed in working buffer (Hank’s balanced salt solution (HBSS) (Life Technologies) with 0.5% chromatographically purified bovine serum albumin (BSA ...
-
bioRxiv - Immunology 2021Quote: ... 2 μL of PCR1 products were amplified by nested PCR using 5 μL of 5X Phusion HF buffer (Thermo Fisher), 0.24 μL of Phusion HF DNA polymerase (2 U/μL ...
-
bioRxiv - Immunology 2021Quote: ... 1% PenStrep and 8 μg/mL puromycin (to ensure retention of TMPRSS2) with 5% CO2 in a 37°C incubator (ThermoFisher). Cells were trypsinized using 0.05% trypsin and plated to be at 90% confluence the following day ...
-
bioRxiv - Microbiology 2021Quote: HeLa and CHO cells were cultivated in a 37°C 5% CO2 incubator and maintained by serial passage in DMEM Glutamax or MEMα (Invitrogen) respectively ...
-
bioRxiv - Developmental Biology 2021Quote: ... a mix containing a 5:1 molar ratio of the pA-uL11K3A-HA expression vector and the selection plasmid pCoBlast (Invitrogen) was prepared ...
-
bioRxiv - Molecular Biology 2020Quote: ... DIV14 neurons were incubated with 200 µM 5-EU (Click-iT™ Nascent RNA Capture Kit, Invitrogen, cat. no. C10365) for 0 (input and “unlab”) ...
-
bioRxiv - Immunology 2021Quote: ... CEM.NKr CCR5+ cells (NIH AIDS reagent program) were maintained at 37°C under 5% CO2 in Roswell Park Memorial Institute (RPMI) 1640 medium (Gibco) containing 10% FBS and 100 μg/ml of penicillin-streptomycin ...
-
bioRxiv - Neuroscience 2021Quote: ... mixed with 0.5 μL 20X TaqMan Gene Expression Assays and 5 μL of 2X TaqMan Universal PCR Master Mix (Applied Biosystems) for a final volume of 10 μL ...
-
bioRxiv - Cancer Biology 2020Quote: ... The CH12.F3 mouse B lymphocyte cell line (a generous gift from T. Honjo (Kyoto Univ.)) was cultured in RPMI/10% FCS/5% NCTC-109 (Invitrogen)/1X Penn-Strep/50μM αMeOH ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μL of 30 μM P3/P6 PCR1 oligo mix and 0.5 μl of 15x SYBR Green I (ThermoFisher Scientific). Real-time quantitative PCR was performed ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were heated to 99 °C for 15 min and aliquots (5 µL) resolved by SDS-PAGE on 8 % – 16 % Tris-glycine minigels (Invitrogen) (150 V ...
-
bioRxiv - Microbiology 2020Quote: ... for 1 h at 37°C 5% CO2 in DMEM and then cells were reverse transfected with 2 μg of GFP using lipofectamine2000 (Invitrogen) in 6 well plate.
-
bioRxiv - Microbiology 2020Quote: Vero Ccl-81 cells (ATCC) were maintained Dulbecco Modified Eagle media supplemented with 5% Fetal Bovine Serum 10 units/mL penicillin (Gibco), 10 μg/mL streptomycin (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... Purified total bacterial RNA from each of the 5 tubes was pooled and genomic DNA removed using the TURBO DNA-free kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... the MYD88 morpholino 5’GTTAAACACTGACCCTGTGGATCAT3’ (Bates et al., 2007) was diluted to 2mM in 0.5 x tango buffer (Thermo Scientific), containing 2% phenol red sodium salt solution (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was isolated from groups of 5 HIOs per replicate with a total of 4 replicates per infection condition using the mirVana miRNA Isolation Kit (ThermoFisher). Cytosolic and mitochondrial ribosomal RNAs were removed from samples using the Ribo-Zero Gold Kit according to manufacturer’s protocol (Illumina) ...
-
bioRxiv - Neuroscience 2021Quote: ... Following secondary antibody incubation samples were washed 3 times for 5 minutes with PBS and then mounted on glass slides in ProLong Glass Antifade Mountant (P36984, Invitrogen) with a #1 coverslip ...
-
bioRxiv - Neuroscience 2021Quote: ... cell lines were cultured under standard conditions (37°C and 5% CO2) using cell culture medium containing Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, #105566-016) supplemented with 1X Penicillin/Streptomycin (100X ...
-
bioRxiv - Neuroscience 2021Quote: ... cells at 80-90% confluence were suspended using a pre-warmed 0.25% trypsin-EDTA solution for 5 minutes maximum (Gibco SH30236.02) and transferred to 35 mm glass bottom culture dishes (Mutsunami D1130H ...
-
bioRxiv - Cancer Biology 2020Quote: ... For the image-based flow cytometry analyses cells were incubated for 20 min in PBS with 5 μg/ml Hoechst33342 (ThermoFisher), prior to harvest ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed in a Quantstudio 5 Real-Time PCR Instrument using SYBR Green PCR Master Mix (Applied Biosystems). Three biological replicates were carried out ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells were transfected with Lenti-pCDH-CSP or Lenti-pCDH control plasmids with psPAX2 and pMD2.G packaging plasmids as ratio 20:15:5 using Lipofectamine 3000 (Invitrogen) to obtain the lentivirus ...
-
bioRxiv - Neuroscience 2021Quote: ... the cell suspension was centrifuged at 200 g for 5 minutes and the resulting pellet was resuspended in 1 mL of DMEM (Gibco) supplemented with 10% FBS and 1% antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Neuroscience 2021Quote: ... Then slides were washed 3×5’ in TBS and incubated in donkey-α-sheep-488 (1:500, Life Technologies, A11015) in TBS for 90’ ...
-
bioRxiv - Neuroscience 2021Quote: ... were plated at 2.5×104 cells/ well of a 96 well plate in HAP1 media (Iscove’s Modified Dulbecco’s Medium (IMDM) (Gibco 12440-053) + 20% FBS (Gibco A38400-01) ...
-
bioRxiv - Pathology 2021Quote: ... Samples were transferred to a PepMap 100 C18 trap column (100 µm x 2 cm, 5 µM particles, Thermo Scientific) and separated on an analytical column (PepMap RSLC C18 ...
-
bioRxiv - Microbiology 2021Quote: ... target cells were labelled with 5 µM of carboxyfluorescein succinimidyl ester (CFSE) from a CFSE cell proliferation kit (Invitrogen, C34554) for 5 min at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR mixtures were assembled using 50 ng or 5 µl cDNA and PowerUp SYBR Green Master Mix (Applied Biosystems). For VEEV detection ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were seeded on a 6-well plate with 2 ml of DMEM medium supplemented with 5% horse serum (Gibco). At 24 hours after transfection ...
-
bioRxiv - Biochemistry 2020Quote: ... 2020) were generated by PCR-amplifying 5’ UTR sequences from pRF plasmids using AccuPrime Pfx DNA Polymerase (Thermo, Invitrogen, 12344024). pSP73-4xS1m(MCS ...
-
bioRxiv - Biochemistry 2020Quote: ... washed twice in PBS and resuspended in around 0.5 mL Staining Solution (5 μg/mL propidium iodide (P3566, ThermoFisher Scientific), 100 μg/mL RNase A (R5503-100MG ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were then washed 3x in HBSS and dissociated by pipetting up and down 15-20 times through a P1000 pipette in growth media (Neurobasal media supplemented with 5 % FBS, 500 nM L-glutamine, B27 (Gibco) and Pen-strep ...
-
bioRxiv - Bioengineering 2021Quote: ... followed by buffer exchange using the 0.5 ml centrifugal filter described above (cat. no. UFC503024, MilliporeSigma) and 10 mM ammonium acetate buffer (cat. no. AM9070G, Invitrogen).
-
bioRxiv - Bioengineering 2021Quote: T cells were cultured in OpTimizer CTS T Cell Expansion SFM containing 5% CTS Immune Cell SR (ThermoFisher, Waltham, MA), L-Glutamine ...
-
bioRxiv - Immunology 2021Quote: ... 4 million splenocytes cells were stimulated ex vivo for 3 hours at 5% CO2 at 37°C in Minimum Essential Media (Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2020Quote: ... was analyzed using an Agilent 1100 HPLC system equipped with a MAbPac HIC-Butyl column (4.6 × 100 mm, 5 µm, Thermo Scientific). Elution conditions were as follows ...
-
bioRxiv - Bioengineering 2020Quote: ... Samples were analyzed using an Agilent 1100 HPLC system equipped with a MAbPac SEC analytical column (4.0 × 300 mm, 5 µm, Thermo Scientific). Elution conditions were as follows ...
-
bioRxiv - Biophysics 2021Quote: ... at 37 °C in a 5% (v/v) CO2 humidified environment (Forma Steri-Cycle CO2 incubator, Thermo Fisher Scientific, Singapore).
-
bioRxiv - Neuroscience 2022Quote: ... Reverse transcription of polyA mRNA from 5 µg total DNA-free RNA was performed using Superscript First Strand Synthesis (Invitrogen) with Oligo-dT primers ...
-
bioRxiv - Microbiology 2022Quote: Hemolymph sporozoites collected on days 19 to 24 post-infection were centrifuged for 5 min at 450 x g and 4 °C in an 8-well Lab-Tek chamber slide (Nunc) or a 384-well plate (Greiner) ...
-
bioRxiv - Neuroscience 2022Quote: ... with added penicillin/streptomycin for 30 min at 37°C and 5% CO2 and then incubated with 50 μg/ml transferrin-Alexa-568 (ThermoFisher) in complete culture media for 20 min at 4°C ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... boiled for 5 min and size-fractionated by gel electrophoresis on NuPAGE 10% Bis-Tris 1.5-mm gels (Life Technologies) in 2-(N-morpholino ...
-
bioRxiv - Developmental Biology 2022Quote: ... Merril 108 and Tcf7-/- mESCs previously generated in the laboratory 37 were cultured at 37°C and 5% CO2 on gelatin-coated plates in DMEM (Gibco), 15% fetal bovine serum ...
-
bioRxiv - Genetics 2022Quote: ... as well as fibroblasts and SH-SY5Y cells treated for 5 hours with 100 µM oleic acid (OA) following over-night starvation in Opti-MEM (ThermoFisher). OA is a potent inducer of lipid droplet formation (55) ...
-
bioRxiv - Microbiology 2022Quote: ... siRNA reverse transfection was performed by mixing 1.2 µl siRNA 5 µM with 1 µl lipofectamine RNAiMAX transfection reagent (Invitrogen, ThermoFisher Scientific) to a final volume of 100 µl with Opti-MEM® (Gibco ...
-
bioRxiv - Microbiology 2022Quote: ... Cell lines were grown at 37°C and 5% CO2 in high-glucose Dulbecco’s Modified Eagles Medium (Thermo Fisher Scientific) supplemented with 10% heat-inactivated fetal bovine serum ...
-
bioRxiv - Physiology 2022Quote: ... The DMEM medium was supplemented with 5% penicillin/streptomycin resistance solution (Sangon, China) and 10% fetal bovine serum (Gibco, USA). The cells were grown at 37 °C with 5% CO2 and sub-cultured every 2–3 days ...
-
bioRxiv - Immunology 2022Quote: ... CD4+ T helper cell subsets were identified using the antibodies listed above and the addition of anti-IL-5 (for Th2) and anti-IFNγ (for Th1) after permeabilization (Invitrogen). Gates were set according to Fluorescence Minus One (FMO ...