Labshake search
Citations for Thermo Fisher :
9701 - 9750 of 10000+ citations for 5 NITROFURFURYL ALCOHOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Coverslips were then washed 3x for 5 minutes with 1xPBS before mounting onto glass slides using ProLong Diamond anti-fade mountant (Invitrogen) and left to dry for 24hrs before imaging ...
-
bioRxiv - Developmental Biology 2022Quote: ... Blots were incubated for 5 minutes with 1 ml of Supersignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, 34095) and the final blot were imaged using the ‘chemi high-resolution’ setting on a Bio-Rad ChemiDoc MP System.
-
bioRxiv - Cancer Biology 2022Quote: ... These three cell lines were grown at 5% CO2 and 37° C in RPMI 1640 without L-Glutamine media supplemented with heat inactivated 10% FBS (Gibco), penicillin/streptomycin (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... The filtrate was spun at 500 x g for 5 min to pellet the cells that were then resuspended in Ham’s F-10 growth media (Thermo Fisher), 20% FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells (CCL-2, ATCC) were maintained in T-75 flasks (Falcon) at 37 °C and 5% CO2 in DMEM (Gibco) supplemented with 4.5 g/L glucose ...
-
bioRxiv - Cancer Biology 2022Quote: ... and maintained at 37 °C in a humidified atmosphere of 5% CO2 (Stericycle CO2 incubator, Thermo Scientific, Waltham, MA, USA). The cell line was authenticated (STR profiling ...
-
bioRxiv - Cell Biology 2022Quote: ... dissociated neurons were resuspended and cultured at 37°C in a humidified incubator with 5% CO2 and 95% O2 in poly-D-lysine coated 6-well plates in neurobasal media (12349015, Gibco) supplemented with 1% GlutaMAX™ Supplement (35050-061 ...
-
bioRxiv - Cancer Biology 2022Quote: ... mechanically dissociated into small fragments using narrow aperture glass pipettes then digested briefly for 5 min at 37°C in TrypLE express (Gibco) which was then quenched using DMEM (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and these cells were cultured by a standard protocol at 37 °C with 5 % CO2 in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin (ThermoFisher).
-
bioRxiv - Neuroscience 2020Quote: ... with 1% PBS-T (1% Triton X-100 in 1x PBS) and blocked in 1% PBS-T containing 5% normal goat serum (ThermoFisher) for one hour ...
-
bioRxiv - Plant Biology 2021Quote: ... The 10 μL reaction mixture was prepared as follows: 5 μL TaqMan™ Fast Universal PCR Master Mix (Applied Biosystems), 0.2 μL each of forward and reverse primers (0.2 uM) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then spinned down (1000 rcf, 5 min) and equally distributed in wells containing growth medium (DMEM-F12-glutamax [Gibco] ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) staining was performed using Click-iT EdU Alexa Fluor 488 Imaging Kit (Thermo Fisher Scientific) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: Cells were cultured at 37°C and 5% CO2 in growth medium containing high glucose Dulbecco’s Modified Eagle Medium (ThermoFisher Scientific) supplemented with 10% (v/v ...
-
bioRxiv - Neuroscience 2019Quote: ... and typically passaged at 80-95% confluence using a pre-warmed 0.25% trypsin-EDTA solution for a maximum of 5 minutes (Gibco SH30236.02).
-
bioRxiv - Microbiology 2021Quote: ... Peptides were initially trapped in C18 PepMap100 pre-column (300 µm inner diameter x 5 mm, 100A, Thermo Fisher Scientific) in Solvent A (Formic acid 0.1% (v/v) ...
-
bioRxiv - Microbiology 2021Quote: Bacteria (~5 × 107 bacteria/ml) added to RPMI-HSA supplemented with 1 μM of Sytox Green Dead Cell stain (Thermofisher) or 30 μM DiOC2 (PromoCell) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 354235], 50 μL of DNase [5 mg/mL, GoldBio, D-301], 100 μL of Collagenase Type I [480U/mL, Gibco, 17100-017] in 9 mL of PBS [Gibco ...
-
bioRxiv - Cell Biology 2019Quote: ... Non-specific binding sites were blocked for 2 h at room temperature with 5% normal SVF (Gibco, ThermoFisher Scientific, France) in 0.1% Triton X-100-PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... Non-specific binding sites were blocked for 2 h at room temperature with 5% normal SVF (Gibco, ThermoFisher Scientific, France) in 0.1% Triton X-100-PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were washed three times for 5 minutes with PBS before incubation with streptavidin with fluorescent tag (Alexa Fluor 647 – Thermofisher) in blocking solution at 1:1000 dilution for 1.5hrs ...
-
bioRxiv - Neuroscience 2021Quote: ... Neurons were then plated on collagen-coated 35 mm Petri dishes (Biocoat) and maintained in culture at 37°C (95% air/5% CO2) with the following medium: Neurobasal-A (Gibco) completed with L-glutamine (Lonza ...
-
bioRxiv - Molecular Biology 2021Quote: For tracking experiments cells were labelled with 5 nM JF549-HaloTag ligand for 15-30 minutes at 37 °C in mouse ES imaging medium (FluoroBrite DMEM (ThermoFisher, 10 % FCS supplemented with nonessential amino acids ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 mM MgCl2 and 0.5 mM MnCl2) and quantified by using Pierce™ BCA Protein Assay Kit (23227, Thermo scientific). In the case of protease digestions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Untranslated regions were cloned using synthetic DNA (Integrated DNA Technologies) or by isolation using 5′ RACE (RLM-RACE kit, Invitrogen). Template was PCR amplified using Phusion polymerase from the plasmids using the following primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsinized hippocampi were washed two times with the same HBSS buffer before being triturated 5-6 times with a fire-polished glass Pasteur pipette in BME (Invitrogen) supplemented with 10 percent FBS (VWR) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the blot was incubated for 5 min with SuperSignal™ West Pico PLUS Chemiluminiscent substrate (Thermo scientific, cat. No. 34577), exposed on film and developed.
-
bioRxiv - Cell Biology 2020Quote: ... proteins were transferred onto a nitrocellulose membrane and then blocked overnight while shaken at 4 °C in TBST-5% BSA—a TBS Tween-20 (TBST; ThermoFisher) solution containing 5% bovine serum albumin (BSA ...
-
bioRxiv - Neuroscience 2021Quote: ... Brains were extracted from rats aged postnatal day 5-7 and placed in working buffer (Hank’s balanced salt solution (HBSS) (Life Technologies) with 0.5% chromatographically purified bovine serum albumin (BSA ...
-
bioRxiv - Immunology 2021Quote: ... 2 μL of PCR1 products were amplified by nested PCR using 5 μL of 5X Phusion HF buffer (Thermo Fisher), 0.24 μL of Phusion HF DNA polymerase (2 U/μL ...
-
bioRxiv - Immunology 2021Quote: ... 1% PenStrep and 8 μg/mL puromycin (to ensure retention of TMPRSS2) with 5% CO2 in a 37°C incubator (ThermoFisher). Cells were trypsinized using 0.05% trypsin and plated to be at 90% confluence the following day ...
-
bioRxiv - Microbiology 2021Quote: HeLa and CHO cells were cultivated in a 37°C 5% CO2 incubator and maintained by serial passage in DMEM Glutamax or MEMα (Invitrogen) respectively ...
-
bioRxiv - Developmental Biology 2021Quote: ... a mix containing a 5:1 molar ratio of the pA-uL11K3A-HA expression vector and the selection plasmid pCoBlast (Invitrogen) was prepared ...
-
bioRxiv - Molecular Biology 2020Quote: ... DIV14 neurons were incubated with 200 µM 5-EU (Click-iT™ Nascent RNA Capture Kit, Invitrogen, cat. no. C10365) for 0 (input and “unlab”) ...
-
bioRxiv - Immunology 2021Quote: ... CEM.NKr CCR5+ cells (NIH AIDS reagent program) were maintained at 37°C under 5% CO2 in Roswell Park Memorial Institute (RPMI) 1640 medium (Gibco) containing 10% FBS and 100 μg/ml of penicillin-streptomycin ...
-
bioRxiv - Neuroscience 2021Quote: ... mixed with 0.5 μL 20X TaqMan Gene Expression Assays and 5 μL of 2X TaqMan Universal PCR Master Mix (Applied Biosystems) for a final volume of 10 μL ...
-
bioRxiv - Cancer Biology 2020Quote: ... The CH12.F3 mouse B lymphocyte cell line (a generous gift from T. Honjo (Kyoto Univ.)) was cultured in RPMI/10% FCS/5% NCTC-109 (Invitrogen)/1X Penn-Strep/50μM αMeOH ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μL of 30 μM P3/P6 PCR1 oligo mix and 0.5 μl of 15x SYBR Green I (ThermoFisher Scientific). Real-time quantitative PCR was performed ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were heated to 99 °C for 15 min and aliquots (5 µL) resolved by SDS-PAGE on 8 % – 16 % Tris-glycine minigels (Invitrogen) (150 V ...
-
bioRxiv - Microbiology 2020Quote: ... for 1 h at 37°C 5% CO2 in DMEM and then cells were reverse transfected with 2 μg of GFP using lipofectamine2000 (Invitrogen) in 6 well plate.
-
bioRxiv - Microbiology 2020Quote: Vero Ccl-81 cells (ATCC) were maintained Dulbecco Modified Eagle media supplemented with 5% Fetal Bovine Serum 10 units/mL penicillin (Gibco), 10 μg/mL streptomycin (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... Purified total bacterial RNA from each of the 5 tubes was pooled and genomic DNA removed using the TURBO DNA-free kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... the MYD88 morpholino 5’GTTAAACACTGACCCTGTGGATCAT3’ (Bates et al., 2007) was diluted to 2mM in 0.5 x tango buffer (Thermo Scientific), containing 2% phenol red sodium salt solution (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was isolated from groups of 5 HIOs per replicate with a total of 4 replicates per infection condition using the mirVana miRNA Isolation Kit (ThermoFisher). Cytosolic and mitochondrial ribosomal RNAs were removed from samples using the Ribo-Zero Gold Kit according to manufacturer’s protocol (Illumina) ...
-
bioRxiv - Neuroscience 2021Quote: ... Following secondary antibody incubation samples were washed 3 times for 5 minutes with PBS and then mounted on glass slides in ProLong Glass Antifade Mountant (P36984, Invitrogen) with a #1 coverslip ...
-
bioRxiv - Neuroscience 2021Quote: ... cell lines were cultured under standard conditions (37°C and 5% CO2) using cell culture medium containing Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, #105566-016) supplemented with 1X Penicillin/Streptomycin (100X ...
-
bioRxiv - Neuroscience 2021Quote: ... cells at 80-90% confluence were suspended using a pre-warmed 0.25% trypsin-EDTA solution for 5 minutes maximum (Gibco SH30236.02) and transferred to 35 mm glass bottom culture dishes (Mutsunami D1130H ...
-
bioRxiv - Cancer Biology 2020Quote: ... For the image-based flow cytometry analyses cells were incubated for 20 min in PBS with 5 μg/ml Hoechst33342 (ThermoFisher), prior to harvest ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed in a Quantstudio 5 Real-Time PCR Instrument using SYBR Green PCR Master Mix (Applied Biosystems). Three biological replicates were carried out ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells were transfected with Lenti-pCDH-CSP or Lenti-pCDH control plasmids with psPAX2 and pMD2.G packaging plasmids as ratio 20:15:5 using Lipofectamine 3000 (Invitrogen) to obtain the lentivirus ...