Labshake search
Citations for Thermo Fisher :
9451 - 9500 of 10000+ citations for 5 NITROFURFURYL ALCOHOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... The second round PCR reaction included 5 uL of 1X Platinum SuperFi Library Amplification Master Mix (Thermo Fisher, Waltham, Massachusetts), 5 uL of the first round PCR product ...
-
bioRxiv - Neuroscience 2020Quote: ... at a density of 300 cells/mm2 and incubated at 37 °C and 5 % CO2 in a humid atmosphere in DMEM (Invitrogen) supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... red blood cells (RBCs) were lysed for 5 min at room temperature using ammonium-chloride-potassium (ACK) buffer (Life Technologies). After centrifugation ...
-
bioRxiv - Neuroscience 2020Quote: ... HEK293T cells and HeLa cells were cultured at 37°C in 5% CO2 in DMEM (Biological Industries) supplemented with 10% (v/v) fetal bovine serum (FBS, Gibco) and 1% penicillin-streptomycin (Gibco).
-
bioRxiv - Neuroscience 2020Quote: ... Cultures were kept at 37 °C and 5 % CO2 in equilibrated maintenance medium containing 96 % Neurobasal medium (Gibco, Cat.# 21103049), 2 % B-27 plus Supplement (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... The beads were then washed with 1mL of ice-cold lysis buffer four times before elution of bound material via a 5 min incubation at 98 °C with 30 μL of 2x LDS buffer (Invitrogen). About 25 μL of eluate was collected by centrifugation ...
-
bioRxiv - Bioengineering 2021Quote: ... 10 µg of each sample was boiled at 95°C for 5 min and loaded onto the 4-12% Bis-Tris Gel (NP0336, ThermoFisher). Gels were run for 1 hour and 15 min at 120 V in with NuPage MES Buffer (NP0002 ...
-
bioRxiv - Immunology 2020Quote: ... and before adoptive transfer thawed and rested overnight at 37°C and 5% CO2 in RPMIc (RPMI 1640 (Gibco; 31870074) with 5% human serum (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... siRNAs and Gapmers or shRNAs were introduced to primary hippocampal neurons (5–8 days in vitro (DIV)) using Lipofectamine RNAiMAX or Lipofectamine 2000 (Invitrogen) according to manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2021Quote: ... for the last 30 min of the drug treatment in L-methionine-depleted medium containing 5% dialyzed fetal calf serum (FCS; Gibco). Harvested cells were washed with PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... using vacuum filtration (Berg and Turner, 1990) and resuspended into 5% RMB (RMB, including 9.13 g/L Na2HPO4 (Fisher Scientific), 4.87 g/L NaH2PO4·H2O (Amresco) ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples were analyzed using an Agilent 1100 HPLC system equipped with a MAbPac SEC-1 analytical column (4.0 × 300 mm, 5 µm, Thermo Scientific). The conditions were as follows ...
-
bioRxiv - Bioengineering 2021Quote: ... The reaction was monitored using an Agilent 1100 HPLC system equipped with a MAbPac HIC-Butyl column (4.6 × 100 mm, 5 µm, Thermo Scientific). Elution conditions were as follows ...
-
bioRxiv - Bioengineering 2021Quote: ... and exposed to 25 µM DRAQ5 Fluorescent Probe for 5 min at room temperature under agitation (#62254, Thermo Scientific™).
-
bioRxiv - Biophysics 2021Quote: Cells were magnetically labelled thanks to an incubation of 2h with a solution of iron oxide nanoparticles at [Fe] = 4 mM and supplemented with 5 mM citrate in RPMI medium (Gibco). The viability and the proliferation of cells after magnetic labelling were assessed by Alamar Blue showing no impact of the magnetic labelling right after the labelling or after one day (Supplementary Figure 1).
-
bioRxiv - Biochemistry 2020Quote: ... 5 DNA and protein concentrations were measured using a NanoDrop ND-2000 UV-visible spectrophotometer (Thermo Fisher Scientific, Nottingham, UK).
-
bioRxiv - Biochemistry 2020Quote: ... After transfer and blocking of polyvinylidene fluoride (PVDF) membranes (Immobilon) in 5% BSA TBS Tween-20 buffer (Thermo Fisher Scientific), primary antibody directed against FADS2 (PA5-87765 ...
-
bioRxiv - Biochemistry 2020Quote: ... was added to the cells and incubated in the dark for 5-10 minutes prior to reading on a Varioskan LUX plate reader (ThermoFisher). Measurements were done in duplicate and relative luciferase units (RLU ...
-
bioRxiv - Bioengineering 2020Quote: ... The cells were incubated at 37°C in an atmosphere of 5% CO2 in air in Low-glucose Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, Invitrogen, Karlsruhe, Germany) supplemented with 10% heat inactivated Fetal Bovine Serum (FBS ...
-
bioRxiv - Bioengineering 2020Quote: ... Separation was performed on an Aquasil C18 column (250 cm x 3 mm, 5 µm particle size; Thermo Fisher Scinetific) at a flow rate of 1 ml/min ...
-
bioRxiv - Bioengineering 2021Quote: ... Droplets of 5 μL cell-Matrigel mixture were manually deposited onto a high performance #1.5 glass bottom 6-well plate (Fisher Scientific). Data acquisition was performed using a confocal microscope (Nikon A1R HD25 ...
-
bioRxiv - Bioengineering 2021Quote: ... the tissues were washed with PBS (3X, 5 minute interval in the shaker) and goat anti-mouse Alexa 594 (A11005, Invitrogen) 1:200 dilutions was added for 3 hours in RT ...
-
bioRxiv - Bioengineering 2021Quote: ... A similar procedure was used for monolayer cell culture (the cells were rinsed with PBS (3x 5 min) and detached using trypsin (Gibco)).
-
bioRxiv - Bioengineering 2020Quote: ... The cells were passaged at a density of 1:2 to 1:8 after reaching ~80% confluency by detaching with 5 mM EDTA in PBS (Invitrogen 15575-038 diluted in sterile 1X PBS ...
-
bioRxiv - Bioengineering 2020Quote: ... Primary fibroblast passages 2–6 were achieved in culture in 37°C in a 5% CO2 incubator with DMEM High Glucose (Gibco) with 10% FBS to 80% confluence in 100 mm Petri dishes ...
-
bioRxiv - Bioengineering 2020Quote: ... Mabs were transduced by nLacZ lentiviral particles and cultured on Falcon dishes at 37°C with 5% CO2 in DMEM GlutaMAX (Gibco) supplemented with heat-inactivated 10% fetal bovine serum (FBS) ...
-
bioRxiv - Bioengineering 2020Quote: ... Oligonucleotide-loaded sender cells were then stained with 5 µg/mL streptavidin-conjugated Alexa Fluor 647 (Thermo Fisher Scientific S32357) for 30 minutes on ice ...
-
bioRxiv - Bioengineering 2020Quote: ... MSCs were expanded in standard culture conditions (37°C, 21% O2, 5% CO2) in α-MEM (Life Technologies, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2021Quote: ... and cells were collected by peritoneal lavage with 5 mL ice-cold DMEM medium (Gibco, Life Technologies, Grand Island, NY). Peritoneal exudate cells were centrifuged at 200x g and 4oC ...
-
bioRxiv - Biochemistry 2021Quote: ... and cells were collected by peritoneal lavage with 5 mL ice-cold DMEM medium (Gibco, Life Technologies, Grand Island, NY). Peritoneal exudate cells were centrifuged at 200x g and 4oC ...
-
bioRxiv - Biochemistry 2021Quote: ... Unbound primary antibodies were removed by washing four times for 5 min in PBS-T at room temperature followed by incubation with secondary antibodies (Alexa Fluor 546; 1:1000; Invitrogen) and DAPI for 45 min ...
-
bioRxiv - Biochemistry 2021Quote: ... and samples were incubated at 70°C for 5 minutes and loaded onto Bis-Tris 4-12 % gradient gels (ThermoFisher). Bands were stained by CBB and relative band intensity was quantified by scanning and semi-automated analysis in ImageQuant (GE Healthcare).
-
bioRxiv - Molecular Biology 2021Quote: ... aliquots of 10 x 104 uninfected macrophages suspended in 10 mL SFB-free DMEM were incubated with: i) 5 µg of lipofection pBlueBacHis2/CAT plasmid (Invitrogen); ii ...
-
The E3 ubiquitin-protein ligase MDM2 is a novel interactor of the von Hippel-Lindau tumor suppressorbioRxiv - Biochemistry 2020Quote: ... Immune complexes were finally washed 3 times with lysis buffer and eluted by incubating the beads (5’ at 70°C) in 30 μl in 1X NuPAGE LDS sample buffer (Invitrogen) plus 0,1 M DTT ...
-
bioRxiv - Biochemistry 2020Quote: ... and neurons were dissociated in a buffer containing papain and cultured at 5 × 104 cells/cm2 in Neurobasal Medium (Cat#21103049, Gibco/Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Ibaragi, Japan) were cultured in RPMI 1640 medium (Wako Chemicals, Osaka, Japan) supplemented with 5% fetal bovine serum (FBS; GIBCO) at 37°C under humidified air containing 5% CO2 ...
-
bioRxiv - Biochemistry 2020Quote: ... An integrated loading pump was used to load peptides onto a trap column (Acclaim PepMap 100 C18, 5 um particles, 20 mm length, ThermoFisher) at 5 µL/min ...
-
bioRxiv - Neuroscience 2020Quote: HEK293T cells were cultured at 37°C in air containing 5% CO2 in DMEM (Biological Industries) supplemented with 10% (v/v) fetal bovine serum (Gibco) and penicillin (100 unit/mL)-streptomycin (0.1 mg/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were blocked in PBS-T containing 5% NDS and then incubated overnight at 4°C with rabbit anti-PSD95 (1:1000, Invitrogen/ThermoFisher) and guinea pig anti-vGlut2 (1:10,000 ...
-
bioRxiv - Immunology 2020Quote: ... and anti-CD127-PE-Cy5 (clone eBioRDR5; 5 μL; cat. # 15-1278-42) all from Thermo Fisher (Supplementary Fig. 4). mAbs for chemokine receptors (i.e ...
-
bioRxiv - Immunology 2020Quote: ... was added using the primers 5’ GACCGTCTCGAGAAAAGAAAAGTCTTTGGACGATGTGAGC and 3’ GTGACTGAATTCTTACTAATGGTGATGGTGGTGATGGCCGCTCAGCCGGCAGCCTCTGA TCCAC and the product was subsequently cloned into the vector pPIC9K (Invitrogen) between the Xho I and EcoR I sites by doing a three-way ligation (EcoR I ...
-
bioRxiv - Neuroscience 2021Quote: ... A micropipette with a tip diameter between 30-40µm was used to inject 0.5 µl of 5% FluoroRuby (MW 10,000; ThermoFisher Scientific, Leicester, UK) dissolved in 0.9% saline at a depth of 0.5mm ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were washed at least 5 times 20 min and transferred to 0.25% PBT with 1:400 TO-PRO-3 (ThermoFisher #T3605) for 2 nights ...
-
bioRxiv - Neuroscience 2020Quote: We quantified vWA5A and ADAMTS19 protein levels by lysing 5 x 105 cells using Pierce IP Lysis Buffer (Thermo Fisher) following the recommended protocol and measured human vWA5A and ADAMTS19 with high-sensitivity ELISA kits (both from MyBioSource ...
-
bioRxiv - Neuroscience 2021Quote: ... was added to cells in phenol-free DMEM:F12 medium and incubated at 37oC in a 5% CO2 cell culture chamber (Forma Series II Water Jacket; ThermoFisher Scientific) for 30 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were washed 5-6 times over 2 hours in PBT at room temperature and incubated with secondary antibodies (Invitrogen) diluted in NGS-PBT for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... total RNA was reverse-transcribed with 0.5ug of poly (T) adaptor containing a 5’-end universal tag sequence and SuperScript™ II Reverse Transcriptase (Thermofisher). Specific miRNA primers ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were centrifuged for 5 min at 10,000 xg and the protein content of the supernatant was determined using a BCAassay kit (Thermo Scientific). The c-di-AMP concentrations are presented as ng c-di-AMP/mg C ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were centrifuged at 130 × g for 5 min and the pellet was resuspended in culture medium consisting of Neurobasal medium with 2% B27 (Invitrogen), 1% L-Glutamine (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was carried out in unsupplemented NBA using 500 ng of the luciferase reporter construct and 20 ng of a normalizer plasmid pGL4.83-mPGK-hRLuc at 5-6 DIV using Lipofectamine 2000 (Thermo Scientific) with DNA to Lipofectamine ratio of 1:2 ...