Labshake search
Citations for Takara Bio :
401 - 450 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: The full length BRD4 DNA fragment was amplified by PCR from pcDNA4-TO-HA-BRD4FL (Addgene plasmid #31351)61 incorporated into linearized FM5 lentiviral vectors containing standardized linkers (generously provided by David Sanders) using the In-Fusion HD cloning kit (Takara Bio, 638910). BRD4dN-mCh-sspB (Addgene plasmid #121968)31 and NLS-iLID-Ferritin (Addgene plasmid #122147)40 were originally developed and characterized in previous Brangwynne lab studies ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplification was performed by Prime Star DNA polymerase (Takara). The GFP and rGFP were cloned into the multiple cloning site (MCS ...
-
bioRxiv - Microbiology 2024Quote: ... as well as from various feline cell lines using an RNAiso Plus kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... with Takara Ex Premier DNA Polymerase (Takara Bio), are reported in Table S1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and finally fused by a recombination reaction using In-Fusion HD Cloning Kit (Takara Bio). In-Fusion reaction solution was directly used for transformation of TOP10 strain of E ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR (CloneAmp HiFi PCR Premix, Takara-Bio Europe) genotyping was done with primers designed for each knock-out line that allowed for confirming either the presence of the wild-type (F-gt5/R-gt5WT and F-gt3WT/R-gt3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... with the SYBR® Premix Ex Taq (Tli RNaseH Plus, Takara), under conditions recommended by the manufacturer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The expressed protein was then purified using TALON Metal Affinity Resin (Takara Cat. # 635502) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse monoclonal anti-GFP (JL8, Clontech, 632381, 1:1000) mouse monoclonal anti-vinculin (SantaCruz ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reverse transcription was performed by adding Primescript II master mix (Takara) to 1x concentration and incubating for 15min at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... An instrument called a cDNA synthesis kit was used to synthesize cDNA (Takara, Dalian, China). Subsequently ...
-
bioRxiv - Molecular Biology 2024Quote: ... and further processed with SMARTer Stranded RNA-Seq Kit (Takara; 634,839) and illumina Truseq Stranded mRNA Library Prep kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... cerevisiae strain JOS003 using the Quick and Easy Transformation Mix (Clontech). JOS003 is a strain in which the one endogenous EIF4E gene has been replaced by homologous recombination with a KanMX4 cassette ...
-
bioRxiv - Neuroscience 2024Quote: ... Collected crude virus was concentrated with Lenti-X (Takara Bio) following manufacturer instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Titer was determined using Lenti-X qRT-PCR Titration Kit (Takara Bio 631235). pLV-dCas9-p300-P2A-PuroR was a gift from Charles Gersbach (Addgene plasmid # 83889 ...
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were used for staining: anti-FOXG1 (rabbit, Takara, M227, 1:400 dilution), anti-TCF7L2 (rabbit ...
-
bioRxiv - Neuroscience 2024Quote: ... we used SMARTer Stranded Total RNA-seq kit v3 - Pico Input Mammalian (Takara Bio, CA). All libraries were in-house tested for quality control (averaging 23 ng/µL ...
-
bioRxiv - Neuroscience 2024Quote: ... The fragment was then amplified again with primers optimized for InFusion cloning (Takara Bio #638909) (forward ...
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit ...
-
bioRxiv - Microbiology 2024Quote: Each individual SARS-CoV-2 fragment was amplified from their respective plasmids using an exclusive pair of primers (Supplementary Table 2) and high-fidelity PrimeSTAR GXL DNA polymerase (Takara), followed by gel isolation with NucleoSpin Gel and PCR Clean-up (Macherey-Nagel ...
-
bioRxiv - Microbiology 2024Quote: ... PCR conditions consisted in 0.05 U of PrimeSTAR GXL polymerase (Takara Bioscience), 250 nM of each primer ...
-
bioRxiv - Microbiology 2024Quote: ... was reverse-transcribed using a PrimeScript II 1st strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Em/Eh-oscar was amplified using Emerald Amp Max Master Mix (TaKaRa) at 94°C for 3 min ...
-
Caspase cleavage of Influenza A virus M2 disrupts M2-LC3 interaction and regulates virion productionbioRxiv - Microbiology 2024Quote: ... The expressed protein was purified by TALON Metal Affinity Resin (Clontech), cleaved by TEV protease ...
-
bioRxiv - Genetics 2024Quote: Libraries for sequencing were prepared using the SMART-Seq® v4 PLUS Kit (Takara/CloneTech) according to the manufacture’s specifications ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA from two replicates of each strain were extracted at about 20 generations after refeeding using RNAiso Plus (TaKaRa, 9108).
-
bioRxiv - Molecular Biology 2024Quote: ... Polymerase chain reactions were performed using PrimeSTAR Max (Takara). Synthetic genes for mGreenLantern and mLychee were ordered from Integrated DNA Technologies.
-
bioRxiv - Molecular Biology 2024Quote: ... 0.025 U μl−1 of SeqAmp polymerase (Takara Bio) and 0.5 μM Smartseq3 forward (5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG-3′ ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.6 μl PCR mix was dispensed to each well containing the following: 1× SeqAmp PCR buffer (Takara Bio), 0.025 U μl−1 of SeqAmp polymerase (Takara Bio ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the indicated type and amount of RNase Inhibitor (no RNAse inhibitor, 0.003 μl RNase Inhibitor (40 U/μl, Cat. 2313B, TaKaRa), SEQURNA Thermostable RNase inhibitor (Cat ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... and pelleted using the Lenti-X Concentrator (631232; Clontech) according to the manufacturer’s instructions ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... DNA was purified using the standard phenol-chloroform extract method and subjected to DNase I (Takara, 2270 B) treatment and reverse transcription for DRIPc-seq library construction ...
-
bioRxiv - Molecular Biology 2024Quote: ... each RNA sample was treated with DNase I (TAKARA) at 37
-
bioRxiv - Genomics 2024Quote: ... RetroNectin (Takara) was used to coat six-well plate following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: TALON Metal Affinity Resin (TAKARA, Shiga, Japan) was used to purify N-terminal Hisx6-tagged TraR protein ...
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
Regulation of Diseases-Associated Microglia in the Optic Nerve by Lipoxin B4 and Ocular HypertensionbioRxiv - Molecular Biology 2024Quote: ... mRNA was converted to cDNA using SMARTer v4 Ultra Low Input RNA Kit (Clontech, Mountain View, CA). A Diagenode Bioruptor Pico was used to fragment the cDNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative RT-PCR was performed with SYBR Green regent (Takara) on StepOne Plus Real-Time PCR system (Applied Biosystem) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR was performed using PrimeSTAR MAX (TAKARA) with primers (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1X protease inhibitor cocktail (635673; Takara Clontech), 1 mM PMSF ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1X protease inhibitor cocktail (635673; Takara Clontech), 1 mM PMSF ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA encoding FLAG-Rhino was cloned into pPB-2× Ty1-Tjen-EGFP-P2A-BlastR51 using In-Fusion cloning (TAKARA), bearing pPB-FLAG-Rhino-Tjen-EGFP-P2A-BlastR ...
-
bioRxiv - Genomics 2024Quote: ... The cells were infected with prepackaged lentiviral particles (constitutive reporter vector expressing tdTomato fluorescent protein gene driven by EF1a promoter (Takara) at MOI of 20 (Stock ...
-
bioRxiv - Molecular Biology 2024Quote: ... Agarose gel electrophoresis on a Mupid EX system (Takara) was performed in 400 mL of 1× MOPS buffer at 20 V for 20 min and then at 100 V until the bromophenol blue dye migrated approximately 2/3 of the gel ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1.25 units ExTaq (TaKaRa), 1× ExTaq buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plug was equilibrated twice in 1 mL of 1× M buffer (TaKaRa) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... YCplac22 plasmids that carry the cac1-20 mutant allele were constructed using the PrimeSTAR Mutagenesis Basal Kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... using Random Primer DNA Labeling Kit (TaKaRa), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... the plug was incubated in 160 μL of 1× M buffer containing 160 units of NheI (TaKaRa) overnight at 37°C ...