Labshake search
Citations for Takara Bio :
351 - 400 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... PCR (CloneAmp HiFi PCR Premix, Takara-Bio Europe) genotyping was done with primers designed for each knock-out line that allowed for confirming either the presence of the wild-type (F-gt5/R-gt5WT and F-gt3WT/R-gt3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... with the SYBR® Premix Ex Taq (Tli RNaseH Plus, Takara), under conditions recommended by the manufacturer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The expressed protein was then purified using TALON Metal Affinity Resin (Takara Cat. # 635502) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse monoclonal anti-GFP (JL8, Clontech, 632381, 1:1000) mouse monoclonal anti-vinculin (SantaCruz ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reverse transcription was performed by adding Primescript II master mix (Takara) to 1x concentration and incubating for 15min at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... An instrument called a cDNA synthesis kit was used to synthesize cDNA (Takara, Dalian, China). Subsequently ...
-
bioRxiv - Molecular Biology 2024Quote: ... and further processed with SMARTer Stranded RNA-Seq Kit (Takara; 634,839) and illumina Truseq Stranded mRNA Library Prep kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... cerevisiae strain JOS003 using the Quick and Easy Transformation Mix (Clontech). JOS003 is a strain in which the one endogenous EIF4E gene has been replaced by homologous recombination with a KanMX4 cassette ...
-
bioRxiv - Neuroscience 2024Quote: ... Collected crude virus was concentrated with Lenti-X (Takara Bio) following manufacturer instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Titer was determined using Lenti-X qRT-PCR Titration Kit (Takara Bio 631235). pLV-dCas9-p300-P2A-PuroR was a gift from Charles Gersbach (Addgene plasmid # 83889 ...
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were used for staining: anti-FOXG1 (rabbit, Takara, M227, 1:400 dilution), anti-TCF7L2 (rabbit ...
-
bioRxiv - Neuroscience 2024Quote: ... we used SMARTer Stranded Total RNA-seq kit v3 - Pico Input Mammalian (Takara Bio, CA). All libraries were in-house tested for quality control (averaging 23 ng/µL ...
-
bioRxiv - Neuroscience 2024Quote: ... The fragment was then amplified again with primers optimized for InFusion cloning (Takara Bio #638909) (forward ...
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit ...
-
bioRxiv - Microbiology 2024Quote: Each individual SARS-CoV-2 fragment was amplified from their respective plasmids using an exclusive pair of primers (Supplementary Table 2) and high-fidelity PrimeSTAR GXL DNA polymerase (Takara), followed by gel isolation with NucleoSpin Gel and PCR Clean-up (Macherey-Nagel ...
-
bioRxiv - Microbiology 2024Quote: ... PCR conditions consisted in 0.05 U of PrimeSTAR GXL polymerase (Takara Bioscience), 250 nM of each primer ...
-
bioRxiv - Microbiology 2024Quote: ... was reverse-transcribed using a PrimeScript II 1st strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Em/Eh-oscar was amplified using Emerald Amp Max Master Mix (TaKaRa) at 94°C for 3 min ...
-
Caspase cleavage of Influenza A virus M2 disrupts M2-LC3 interaction and regulates virion productionbioRxiv - Microbiology 2024Quote: ... The expressed protein was purified by TALON Metal Affinity Resin (Clontech), cleaved by TEV protease ...
-
bioRxiv - Genetics 2024Quote: Libraries for sequencing were prepared using the SMART-Seq® v4 PLUS Kit (Takara/CloneTech) according to the manufacture’s specifications ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA from two replicates of each strain were extracted at about 20 generations after refeeding using RNAiso Plus (TaKaRa, 9108).
-
bioRxiv - Molecular Biology 2024Quote: ... 0.025 U μl−1 of SeqAmp polymerase (Takara Bio) and 0.5 μM Smartseq3 forward (5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG-3′ ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.6 μl PCR mix was dispensed to each well containing the following: 1× SeqAmp PCR buffer (Takara Bio), 0.025 U μl−1 of SeqAmp polymerase (Takara Bio ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the indicated type and amount of RNase Inhibitor (no RNAse inhibitor, 0.003 μl RNase Inhibitor (40 U/μl, Cat. 2313B, TaKaRa), SEQURNA Thermostable RNase inhibitor (Cat ...
-
bioRxiv - Molecular Biology 2024Quote: ... each RNA sample was treated with DNase I (TAKARA) at 37
-
bioRxiv - Genomics 2024Quote: ... RetroNectin (Takara) was used to coat six-well plate following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: TALON Metal Affinity Resin (TAKARA, Shiga, Japan) was used to purify N-terminal Hisx6-tagged TraR protein ...
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative RT-PCR was performed with SYBR Green regent (Takara) on StepOne Plus Real-Time PCR system (Applied Biosystem) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR was performed using PrimeSTAR MAX (TAKARA) with primers (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA encoding FLAG-Rhino was cloned into pPB-2× Ty1-Tjen-EGFP-P2A-BlastR51 using In-Fusion cloning (TAKARA), bearing pPB-FLAG-Rhino-Tjen-EGFP-P2A-BlastR ...
-
bioRxiv - Genomics 2024Quote: ... The cells were infected with prepackaged lentiviral particles (constitutive reporter vector expressing tdTomato fluorescent protein gene driven by EF1a promoter (Takara) at MOI of 20 (Stock ...
-
bioRxiv - Molecular Biology 2024Quote: ... Agarose gel electrophoresis on a Mupid EX system (Takara) was performed in 400 mL of 1× MOPS buffer at 20 V for 20 min and then at 100 V until the bromophenol blue dye migrated approximately 2/3 of the gel ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1.25 units ExTaq (TaKaRa), 1× ExTaq buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plug was equilibrated twice in 1 mL of 1× M buffer (TaKaRa) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... YCplac22 plasmids that carry the cac1-20 mutant allele were constructed using the PrimeSTAR Mutagenesis Basal Kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... using Random Primer DNA Labeling Kit (TaKaRa), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... the plug was incubated in 160 μL of 1× M buffer containing 160 units of NheI (TaKaRa) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ChIP-seq libraries were generated using DNA SMART ChIP-seq kits (Takara Bio, 634865) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were analysed by gel electrophoresis and positive products were purified using the NucleoSpin Gel and PCR clean up kit (Clontech, Takara Bio) before being sent for sequencing by Eurofins Genomics (Germany) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were analysed by gel electrophoresis and positive products were purified using the NucleoSpin Gel and PCR clean up kit (Clontech, Takara Bio) before being sent for sequencing by Eurofins Genomics (Germany) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA extracted from the gonads underwent reverse transcription after concentration adjustment with the PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Japan).
-
bioRxiv - Molecular Biology 2024Quote: ... and one μg of RNA was reverse transcribed using a cDNA Reverse Transcription Kit (RR037A, Takara). Final cDNA samples were used then used for quantitative real-time PCR assay by SYBR Green PCR Kit (RR820A ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplification was performed using the Advantage 2 Polymerase Mix (Clonetech, now Takara Bio USA, Mountain View, CA) and the following primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... Final cDNA samples were used then used for quantitative real-time PCR assay by SYBR Green PCR Kit (RR820A, Takara). Quantitative primers were designed based on the gene sequences by Sangon Biotech ...
-
bioRxiv - Molecular Biology 2024Quote: ... The expression vector was produced by inserting the cDNA encoding the Rhino fragment into pGEX-5X-3 (Cytiva) by Infusion (Takara). The primers used are listed in Supplementary Table 1.
-
bioRxiv - Neuroscience 2024Quote: The annealed oligos were ligated with the pGuide-it-sgRNA1 Vector and prepared using the FastGene Plasmid Mini Kit (Nippon Genetics) and NucleoBond Xtra Midi (Takara Bio). Transfection into HEK-293T cells was performed according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2024Quote: ... was produced and purified according to the Guide-it CRISPR/Cas9 Gesicle Production System protocol (Takara Bio) involving oligo-DNA pair annealing in a thermal cycler.
-
bioRxiv - Neuroscience 2024Quote: ... AAV was purified 3–5 days after transfection using AAVpro Purification Kit Midi or Maxi (Takara Bio, Shiga, Japan). The viral concentration was measured by qRT-PCR.