Labshake search
Citations for Takara Bio :
351 - 400 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: The captured cDNA with beads was amplified using LA Taq DNA Polymerase Hot-Start (Takara, # RR042B) in 4x50μl reactions ...
-
bioRxiv - Cell Biology 2024Quote: For immunostaining the following antibodies were used: mouse anti-E-cadherin mAb clones SHE78-7 and HECD1 (Takara, M126 and M106), mouse anti-vinculin (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... a mixture containing 10μl 5x PrimeSTAR buffer (Takara, #R050B), 4μl dNTP (2.5mM ...
-
bioRxiv - Cell Biology 2024Quote: ... facilitated by the PrimeScript RT regent Kit (TaKaRa, Japan). Purification of the synthesized second-stranded DNAs was accomplished using AMPureXP beads ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse transcription was conducted using a reverse transcription kit (TAKARA, Japan) according to the manufacturer’s protocol to synthesize cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... was amplified with primers Fe-227S and Fe-204R using SYBR Premix Ex Taq II (Tli RNaseH Plus; Takara) (Table 2) ...
-
bioRxiv - Microbiology 2024Quote: ... The cDNA was amplified using Premix Ex Taq (Probe qPCR; Takara) in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Developmental Biology 2024Quote: ... with Takara Ex Premier DNA Polymerase (Takara Bio), are reported in Table S1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and finally fused by a recombination reaction using In-Fusion HD Cloning Kit (Takara Bio). In-Fusion reaction solution was directly used for transformation of TOP10 strain of E ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR was performed using TB Green Ex Taq II Mix (Takara) and the Thermal Cycler Dice Real-Time System (Takara).
-
bioRxiv - Molecular Biology 2024Quote: ... and the Thermal Cycler Dice Real-Time System (Takara).
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA prepared from adult mouse livers was reverse-transcribed using a PrimeScript II first-strand cDNA Synthesis Kit (Takara, Shiga, Japan) with a random hexamer primer ...
-
bioRxiv - Cell Biology 2024Quote: ... Flanking att sequences were added through another round of PCR (Takara, cat # R011) and purified ...
-
bioRxiv - Cell Biology 2024Quote: ... the coding sequence of each gene was amplified from whole larva cDNA using PrimeScript RT-PCR Kit (Takara, cat # RR014-A). The amplified sequence was then purified through gel extraction (Magen HiPure Gel Pure DNA Mini kit ...
-
bioRxiv - Cell Biology 2024Quote: ... the annealed LifeAct (forward: 5’-TCGAGATGGGTGTCGCAGATTTGATCAAGAAATTCGAAAGCATCTCAAAG GAAGAAGGG-3’; reverse: 5’-GATCCCTTCTTCCTTTGAGATGCTTTCGAATTTCTTGATCAAATCTGCGACACCCATC-3’) was fused to N-terminal of EGFP-N1 vectors (Clontech). To generate pLifeAct-mCherry-N1 vector ...
-
bioRxiv - Molecular Biology 2024Quote: The full length BRD4 DNA fragment was amplified by PCR from pcDNA4-TO-HA-BRD4FL (Addgene plasmid #31351)61 incorporated into linearized FM5 lentiviral vectors containing standardized linkers (generously provided by David Sanders) using the In-Fusion HD cloning kit (Takara Bio, 638910). BRD4dN-mCh-sspB (Addgene plasmid #121968)31 and NLS-iLID-Ferritin (Addgene plasmid #122147)40 were originally developed and characterized in previous Brangwynne lab studies ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplification was performed by Prime Star DNA polymerase (Takara). The GFP and rGFP were cloned into the multiple cloning site (MCS ...
-
bioRxiv - Microbiology 2024Quote: ... as well as from various feline cell lines using an RNAiso Plus kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... qPCR quantified cDNA via SYBR® Premix Ex Taq™ II (Takara, RR82LR). Each reaction was run in triplicate and analysed following the ΔΔCt value using glyceraldehyde-3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Neuroscience 2024Quote: ... RT–PCR was performed using a TB Green TM Premix Ex Taq Kit (Cat# RR820A, Takara) on a Light Cycler Real-Time PCR System (480II ...
-
bioRxiv - Neuroscience 2024Quote: The total RNA of cells was isolated with RNAiso plus (Cat# 9108, Takara). The concentration and purity of RNA samples were measured using a Nanodrop ND-2000 (Thermo Science ...
-
bioRxiv - Neuroscience 2024Quote: ... which was synthesized with a PrimeScript reverse transcriptase kit (Cat# RR037A, Takara). RT–PCR was performed using a TB Green TM Premix Ex Taq Kit (Cat# RR820A ...
-
bioRxiv - Neuroscience 2024Quote: ... and at 72°C for 30 sec in TaKaRa Thermal Cyclar Dice Touch (Takara).
-
bioRxiv - Neuroscience 2024Quote: ... Reverse transcription was performed with 500 ng of total RNA and PrimeScript™ RT Master Mix (Perfect Real Time) (Takara, Tokyo, Japan). Reverse transcription PCR (RT-PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... The fragments of the mutated DNA library were amplified with primers M13-Plus-FP/M13-Plus-RP and the linearized pUC57-T7Q vector was amplified with primers AS-FP/AS-RP using PrimerSTAR HS DNA polymerase (Takara, R040A) (Supplementary Table S4) ...
-
bioRxiv - Neuroscience 2024Quote: ... A fragment of the mutagenized GluA2 sequence between the BstEII/BspEI restriction sites was then subcloned into the AP-SEP-GluA2 construct (prepared as described in (30)) on a pBI-Tet on vector backbone (Clontech; #6152-1). For AP-SEP-GluA2 ET/YR-BirAER ...
-
bioRxiv - Neuroscience 2024Quote: ... was amplified by PCR and inserted into the Cre-dependent AAV hSyn FLEx vector using BamHI/KpnI restriction sites.pTet-on (transactivator) was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2024Quote: qPCR was performed on a Thermal Cycler Dice Real Time System II (TaKaRa) with THUNDERBIRD SYBR qPCR Mix or Next SYBR qPCR Mix (TOYOBO ...
-
bioRxiv - Genetics 2024Quote: ... we alternatively used in-fusion cloning (Takara Bio) to insert a gBlock (IDT ...
-
bioRxiv - Genetics 2024Quote: ... GFP-fused Actb WT and S348L in pcDNA3-GFP were amplified using KOD One (TOYOBO, Osaka, Japan) and cloned into pCSf107mT[31] using the In-Fusion HD Cloning Kit (Takara, Shiga, Japan) resulting in pCSf107mT-GFP-Actb WT and S348L ...
-
bioRxiv - Genetics 2024Quote: ... This was performed using the In-Fusion HD Cloning Plus Kit (Takara Bio, Shiga, Japan), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... then digested with Proteinase K (Takara) at 55lJ overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
Regulation of Diseases-Associated Microglia in the Optic Nerve by Lipoxin B4 and Ocular HypertensionbioRxiv - Molecular Biology 2024Quote: ... mRNA was converted to cDNA using SMARTer v4 Ultra Low Input RNA Kit (Clontech, Mountain View, CA). A Diagenode Bioruptor Pico was used to fragment the cDNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative RT-PCR was performed with SYBR Green regent (Takara) on StepOne Plus Real-Time PCR system (Applied Biosystem) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and DNA size marker ladders were from Takara. TRIzol reagent from Thermo Fisher Scientific was used for RNA isolation ...
-
bioRxiv - Developmental Biology 2024Quote: Lentiviral particles were produced following transient transfection of the shRNA-pLKO.1 vector and packaging plasmids into Lenti-X cells (632180; Takara Bio USA) using Attractene (301005 ...
-
bioRxiv - Molecular Biology 2024Quote: ... into LentiX-cells (Takara) according to standard procedures ...
-
bioRxiv - Molecular Biology 2024Quote: ... separated by an encephalomyelitis virus internal ribosome entry site (IRES) (Clontech), were cloned into the MCS of an GreS base vector ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR was performed using PrimeSTAR MAX (TAKARA) with primers (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1X protease inhibitor cocktail (635673; Takara Clontech), 1 mM PMSF ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1X protease inhibitor cocktail (635673; Takara Clontech), 1 mM PMSF ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA encoding FLAG-Rhino was cloned into pPB-2× Ty1-Tjen-EGFP-P2A-BlastR51 using In-Fusion cloning (TAKARA), bearing pPB-FLAG-Rhino-Tjen-EGFP-P2A-BlastR ...
-
bioRxiv - Molecular Biology 2024Quote: ... Polymerase chain reactions were performed using PrimeSTAR Max (Takara). Synthetic genes for mGreenLantern and mLychee were ordered from Integrated DNA Technologies.
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... and 20x concentrated using LentiX Concentrator (Takara) according to the manufacturer’s instructions ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 1x Titanium Taq buffer and 2 μL Titanium Taq polymerase (Takara) were mixed in 50 µL total volume ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 1x Titanium Taq buffer and 2 μL Titanium Taq (Takara). PCR cycles were ...
-
bioRxiv - Systems Biology 2024Quote: ... Lenti-X 293T (Takara), and PlatinumE (Cell Biolabs) ...