Labshake search
Citations for Takara Bio :
451 - 500 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and subjected to cDNA synthesis using PrimeScriptTM RT Master Mix (TaKaRa). qPCR was performed using QuantStudio6 Flex System (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Molecular Biology 2024Quote: ... and used with the mixture of specially designed primers (SWITCH2 and RT_universal_primer, Supplementary Table S2) for cDNA synthesis (SMARTScribe Reverse Transcriptase, TaKaRa, Kusatsu, Japan).
-
bioRxiv - Molecular Biology 2024Quote: ... coli DNA ligase (Takara, #2161). The ligated product was amplified with a G-quadruplex-specific common primer (NGS-1290 ...
-
bioRxiv - Neuroscience 2024Quote: ... RT-qPCR was performed using SYBR® Premix Ex Taq™ II (Perfect Real Time, Takara Bio Inc.). SYBR green detection of PCR products was conducted in real time using a MyiQ single-color detection system (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... fragmented RNA library was mixed with 5 µM of PE2-N6 primer (Supplementary Table S1) and reverse transcribed using PrimeScript RTase (Takara, SD0418) for 60Lmin at 42L°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and then further subcloned into pDsRed-Express2 (Clontech, cat no 632535). Due to the GC-rich region being close to the Sox2 TSS ...
-
bioRxiv - Molecular Biology 2024Quote: ... The fragments of the mutated DNA library were amplified with primers M13-Plus-FP/M13-Plus-RP and the linearized pUC57-T7Q vector was amplified with primers AS-FP/AS-RP using PrimerSTAR HS DNA polymerase (Takara, R040A) (Supplementary Table S4) ...
-
bioRxiv - Microbiology 2024Quote: ... DNase-treated total RNA was used to prepare cDNA libraries with the SMARTer smRNA-Seq Kit (Takara Bio, Mountain View, CA). Libraries were sequenced as 50 bp single-end reads on an Illumina HiSeq sequencer ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed using PrimeStarMax (TaKaRa), and the resulting products were checked on agarose gel (1% ...
-
bioRxiv - Microbiology 2024Quote: ... and the Tn7 site homologous fragments (upstream and downstream) were amplified from AB5075 from genomic DNA using the PrimeStar polymerase (Takara).
-
bioRxiv - Neuroscience 2024Quote: ... The tdTomato-tagged Tmem120a construct was generated by PCR cloning Tmem120a using the Origene MR205146 clone as a template and subcloning it to the ptdTomato-N1 vector (Clontech), placing the tdTomato tag to the C-terminus of Tmem120a8 ...
-
bioRxiv - Neuroscience 2024Quote: The mammalian expression vector pBApo-CMV-Pur (cat. #3421) was purchased from Takara. We used Genescript to insert the 144 amino acid sequence for WT synuclein into the backbone and create 6 mutated strains ...
-
bioRxiv - Microbiology 2024Quote: ... The fusion protein was affinity-purified using TALON metal affinity resin (Takara Biosciences) and eluted in buffer containing 50 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was generated using PrimeScript RT kit (Takara RR037A) with 100-500 ng RNA as input ...
-
bioRxiv - Neuroscience 2024Quote: pCAG-XCaMP-R63 (gift from Haruhiko Bito, University of Tokyo) was transformed using Stellar Competent Cells (Takara Bio.), grown in antibiotic-treated LB broth at 37° C ...
-
bioRxiv - Molecular Biology 2024Quote: ... TRIzol (TaKaRa, Japan) was utilized ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative assessment of relative RNA expression was performed via RT-qPCR using SYBR Premix Ex TaqTM (TaKaRa, Japan). The reference gene ...
-
bioRxiv - Molecular Biology 2024Quote: ... 500 ng of total RNA underwent reverse transcription to generate cDNA using the primeScriptTM RT Master Mix reagent kit (TaKaRa, Japan). Quantitative assessment of relative RNA expression was performed via RT-qPCR using SYBR Premix Ex TaqTM (TaKaRa ...
-
bioRxiv - Neuroscience 2024Quote: ... samples in homogenization buffer (Clontech, Cat: 2313A), were thawed on ice ...
-
bioRxiv - Neuroscience 2024Quote: Media was collected 48 h after transfection and clarified by syringe filtration through a 0.45 µm polyvinylidene difluoride membrane (Millex-HV) before concentrating the virus with a Lenti-X concentrator (Clontech 631231). The concentrated virus was resuspended in PBS and aliquoted into single-use tubes stored at −80 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... separated by an encephalomyelitis virus internal ribosome entry site (IRES) (Clontech), were cloned into the MCS of an GreS base vector ...
-
bioRxiv - Molecular Biology 2024Quote: 900 ng of total RNA isolated from HUVEC was used as input for SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio). Sequencing was performed on the NextSeq500 instrument (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the human herpes simplex virus 5 puromycin resistance marker (Clontech).
-
bioRxiv - Microbiology 2024Quote: ... and then cDNA was synthesized and monitored with SuperScript-III kit (Takara, Dalian, China). qRT–PCR analysis was performed using SYBR Green (BIO-RAD ...
-
bioRxiv - Microbiology 2024Quote: ... PCR amplification involved specific primers (Supplementary Table 1) and Ex Taq Polymerase (Takara, Japan) (Choi et al. ...
-
bioRxiv - Microbiology 2024Quote: ... All RNA in the extract samples were converted into cDNA using the cDNA EcoDry Premix (Clontech, USA). Quantitative real-time PCR was performed using a CFX96 Real-Time System (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... packaging plasmid using the CalPhos Mammalian Transfection Kit (Takara). The next day ...
-
bioRxiv - Cell Biology 2024Quote: ... the media was replaced with NDiff227 (Takara) supplemented with 1 μM PD325901 (Stemgent) ...
-
bioRxiv - Cell Biology 2024Quote: ... and lentiviral particles were concentrated using the Lenti-X Concentrator (Takara) as per the instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Genomic DNA was purified from at least 100 million cells of each sample using NucleoSpin Blood XL (Takara) or QIAamp DNA Blood Midi Kit (QIAGEN) ...
-
bioRxiv - Microbiology 2024Quote: ... for genotype analysis was extracted using the Qiagen DNeasy Blood and Tissue kit and PCR analysis was done with CloneAmp™ HiFi PCR Premix (Takara) or Phusion polymerase (NEB).
-
bioRxiv - Microbiology 2024Quote: ... Transfection was performed using 4 µL TransIT 293 (Takara, Shiga, Japan) and 100 µL OPTI-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... reverse transcription was performed using the PrimeScript RT reagent kit (TaKaRa, Kyoto, Japan). Real-time qPCR was carried out on a CFX Duet real-time PCR system (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... that were exposed immediately after infection and for about 44 to 48 h to 1 μg/mL Anhydrotetracycline (631310, TaKaRa, ATc) whereas control cultures were exposed to vehicle only (100% ethanol).
-
bioRxiv - Microbiology 2024Quote: ... Total RNA was extracted using RNApure FFPE Kit (CWBIO, Jiangsu, China) and then treated with DNase I (TaKaRa, Kyoto, Japan) to remove DNA contaminants ...
-
bioRxiv - Microbiology 2024Quote: ... The supernatants from the samples were added to 0.5 ml of a Talon metal affinity resin (Clontech, USA) equilibrated with binding buffer ...
-
bioRxiv - Microbiology 2024Quote: ... was constructed using infusion cloning (Clontech, USA), as previously reported (35) ...
-
bioRxiv - Microbiology 2024Quote: ... using Talon resin (BD ClonTech). Purified proteins were concentrated using 10 kDa cutoff Amicon Ultra Centrifugal Filters (Merck Millipore ...
-
bioRxiv - Microbiology 2024Quote: ... Stellar chemically competent Escherichia coli (Takara Bio) was used to prepare plasmids for ectopic expression in mammalian cells.
-
bioRxiv - Microbiology 2024Quote: ... and simultaneously transformed to the Saccharomyces cerevisiae AH109 strain (Clontech, CA) as described above ...
-
bioRxiv - Microbiology 2024Quote: ... trachomatis L2 (434/Bu) DNA and subcloned into the EcoRI and NotI sites in pcDNA4.0/2xStrepII(54) using In-Fusion cloning (Takara) Tri1-Strep-sfGFP was generated by subcloning superfolder (sf ...
-
bioRxiv - Microbiology 2024Quote: ... The donor vectors were cloned either to the pGADT7-GW prey or the pGBKT7-GW bait plasmids (Takara, Kusatsu, Japan) and simultaneously transformed to the Saccharomyces cerevisiae AH109 strain (Clontech ...
-
bioRxiv - Cancer Biology 2024Quote: ... Activated T cells were transduced with the retroviral supernatant using retronectin-coated plates (Takara Bio Inc, T100B). T cells were harvested after three days and expanded in complete medium (45% RPMI-1640 (Corning ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5U µl-1 RNase Inhibitor (Takara Bio, #2313B), 2.0µM Template Switching Oligo (TSO ...
-
bioRxiv - Cancer Biology 2024Quote: ... reverse-transcribed using a PrimeScript RT reagent Kit (Takara Bio Inc., Otsu, Japan), and amplified using ExTaqII SYBR Premix (Takara Bio Inc. ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cancer Biology 2024Quote: ... MYCN 5′ DEL and 3′ DEL deletion mutants were generated by restriction-free cloning using plasmid PCR amplification and overhang ligation using the In-Fusion Cloning Kit (Takara Bio 638910) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... was cloned from a synthetic gene block and inserted into XbaI and EcoRI linearised empty plasmid pEXT21 (pHD0788) via restriction less cloning (InFusion, Takara). A signal-peptide was included 5’ of the IdeS fragment ...
-
bioRxiv - Microbiology 2024Quote: ... pLPCX(AB) is a version of pLPCX (Clontech Laboratories) in which the EcoRI-ClaI region of the multi-cloning site was removed and replaced by a duplex created by annealing oligodeoxynucleotides Linker-EcoBamNotCla-s (5’-AATTCACGGATCCTTGCGGCCGCAT ...