Labshake search
Citations for Takara Bio :
301 - 350 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: The RBD-DsRed plasmid was created by PCR cloning the HB domain of RNAse H1 into the pDsRed-Express-C1 vector (Clontech), following the previously described method [32].
-
bioRxiv - Cell Biology 2024Quote: ... O’Sullivan and introduced into target plasmids through in-fusion cloning (#638948, Takara Bio). All the target plasmids in this study are derived from a plasmid that contains a CAG promoter for constitutive expression ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1μl PrimeSTAR GXL DNA Polymerase (Takara, #R050B) was made ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4μl dNTP (2.5mM; Takara, #R050B), 1μl Partial R1 – CTACACGACGCTCTTCCGATCT (10μM) ...
-
bioRxiv - Molecular Biology 2024Quote: The captured cDNA with beads was amplified using LA Taq DNA Polymerase Hot-Start (Takara, # RR042B) in 4x50μl reactions ...
-
bioRxiv - Cell Biology 2024Quote: For immunostaining the following antibodies were used: mouse anti-E-cadherin mAb clones SHE78-7 and HECD1 (Takara, M126 and M106), mouse anti-vinculin (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... a mixture containing 10μl 5x PrimeSTAR buffer (Takara, #R050B), 4μl dNTP (2.5mM ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR was performed using TB Green Ex Taq II Mix (Takara) and the Thermal Cycler Dice Real-Time System (Takara).
-
bioRxiv - Molecular Biology 2024Quote: ... and the Thermal Cycler Dice Real-Time System (Takara).
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA prepared from adult mouse livers was reverse-transcribed using a PrimeScript II first-strand cDNA Synthesis Kit (Takara, Shiga, Japan) with a random hexamer primer ...
-
bioRxiv - Cell Biology 2024Quote: ... Flanking att sequences were added through another round of PCR (Takara, cat # R011) and purified ...
-
bioRxiv - Cell Biology 2024Quote: ... the coding sequence of each gene was amplified from whole larva cDNA using PrimeScript RT-PCR Kit (Takara, cat # RR014-A). The amplified sequence was then purified through gel extraction (Magen HiPure Gel Pure DNA Mini kit ...
-
bioRxiv - Microbiology 2024Quote: ... placed in 1mL LBP from the NucleoSpin RNA Plus kit (Clontech #740984.250) with silica disruption beads and snap frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... the solubilized membrane fraction gets incubated with TALON SuperFlow resin (Takara 635502) for 1 hours at 4°C and was later washed using buffer B supplemented with 20 mM imidazole ...
-
bioRxiv - Microbiology 2024Quote: ... and 90 μl of DNase I (1 U/μl) (TAKARA, Japan). The suspension was thoroughly re-suspended ...
-
bioRxiv - Microbiology 2024Quote: ... The fusion protein was affinity-purified using TALON Metal Affinity Resin (Takara Biosciences; Table S4) and eluted in buffer containing 25 mM HEPES ...
-
bioRxiv - Microbiology 2024Quote: ... Lentiviral supernatant was harvested 48 h later and then filtered to be concentrated through a Lenti-X Concentrator (Takara) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and R624W was introduced to pTVT7_YG1_M using In-Fusion HD cloning kit (Takara Bio), primers containing mutation for insert sequence (5′-AACTTGGAAGTGCTTTGTGGTAGG-3′ ...
-
bioRxiv - Microbiology 2024Quote: ... Cloning was conducted using an In-Fusion HD cloning kit (Takara Bio, CA, USA), and the resulting plasmids were named pTVT7_YG1_S ...
-
bioRxiv - Molecular Biology 2024Quote: ... Viruses were extracted and purified by using an AAV extraction kit (Takara).
-
bioRxiv - Cancer Biology 2024Quote: ... Tet System Approved FBS (#631101, Takara) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... Signals were detected with ECL western blotting substrate (TaKaRa) and image was acquired using Azure Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: ... Real time PCR was set up using TB Green Premix Ex Taq II (Tli RNase H Plus) (TakaRa) in a Quantstudio5 machine ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was made using 500ng RNA with PrimeScript RT Reagent Kit (TaKaRa). Real time PCR was set up using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Molecular Biology 2024Quote: ... After 2 hrs 1µl of Reverse Transcriptase (PrimeScript RT, Takara) was added and reverse transcription was performed at 420C for 1hr followed by inactivation at 700C for 30 mins ...
-
bioRxiv - Cancer Biology 2024Quote: ... The SMARTSeq HT Ultra Low Input Kit was used for full-length cDNA synthesis and amplification (Clontech), and Illumina Nextera XT library was used for sequencing library preparation ...
-
bioRxiv - Microbiology 2024Quote: ... and cultured in an overlay medium: MEM containing 0.8% SeaKem ME agarose (Takara, Kusatsu, Japan) and 4% FBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... membranes were then blocked in 5% Skim milk powder (Fujifilm, Cat# 190-12865) mixed with Phosphate buffered saline with tween® (PBS-T) (Takara, Cat# T9183). The chosen primary antibody was then incubated overnight at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... the annealed oligos were ligated into the digested lentiCRISPRv2 backbone using the DNA ligation kit (Mighty Mix) (Takara, Cat# 6023). Afterward ...
-
bioRxiv - Microbiology 2024Quote: ... Library concentration was estimated with the Library Quantification kit (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Tick DNA was extracted using the MightyPrep reagent for DNA Kit (Takara, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... GFP (Clontech), PABPC1 (Santa Cruz ...
-
bioRxiv - Microbiology 2024Quote: ... expressing GFP under the control of the hCMV immediate-early promoter were obtained from Clontech. The construction of plasmids expressing vhs from HSV1 strain17 as vhs-GFP and untagged pcvhs have been described previously (13 ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were then reverse transcribed employing a One-Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa, Japan). Nested PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 μM rapamycin analog AP21967 (AP, Takara 635056) was added ∼ 18 hr post-transfection to treat the cells for 6 – 10 hr to induce coaggregation.
-
bioRxiv - Microbiology 2024Quote: ... and genomic DNA was removed using DNase I (TAKARA, Dalian, China). Next ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed in SYBR Premix Ex Taq II (Takara, Japan) solution using MltE RT-PCR primers (See Table S2 ...
-
bioRxiv - Molecular Biology 2024Quote: IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 µl of lysate was used for PCR using SapphireAMP (Takara, RR350) and primers specific for each gene ...
-
bioRxiv - Molecular Biology 2024Quote: The human embryonic kidney (HEK) 293T cell line was purchased from Takara (Cat# 632180) and cultured in a humidified 95% air / 5% CO2 incubator at 37°C in a standard Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Cancer Biology 2024Quote: ... and concentrated with Lenti-XTM Concentrator (Takara, #631232). Media was replaced and on day 5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... U6 primers (TAKARA) were used to normalize miRNA expression via the 2-ΔΔCq method (ΔCq = Cqtarget − Cqrereference).
-
bioRxiv - Cancer Biology 2024Quote: ... Shield1 (TaKaRa, Cat# 632189). The metabolites used in this study are as follows ...
-
bioRxiv - Cancer Biology 2024Quote: ... The sgRNA sequences were amplified using Taq polymerase (Takara Bio, Inc.) and adapted for sequencing ...
-
bioRxiv - Cell Biology 2024Quote: ... Primary antibodies were diluted using Solution 1 (Takara, NKB-101). Secondary antibodies used for immunoblotting included peroxidase AffiniPure Goat Anti-Rabbit IgG (H+L ...
-
bioRxiv - Molecular Biology 2024Quote: The full length BRD4 DNA fragment was amplified by PCR from pcDNA4-TO-HA-BRD4FL (Addgene plasmid #31351)61 incorporated into linearized FM5 lentiviral vectors containing standardized linkers (generously provided by David Sanders) using the In-Fusion HD cloning kit (Takara Bio, 638910). BRD4dN-mCh-sspB (Addgene plasmid #121968)31 and NLS-iLID-Ferritin (Addgene plasmid #122147)40 were originally developed and characterized in previous Brangwynne lab studies ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplification was performed by Prime Star DNA polymerase (Takara). The GFP and rGFP were cloned into the multiple cloning site (MCS ...
-
bioRxiv - Microbiology 2024Quote: ... as well as from various feline cell lines using an RNAiso Plus kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... with Takara Ex Premier DNA Polymerase (Takara Bio), are reported in Table S1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and finally fused by a recombination reaction using In-Fusion HD Cloning Kit (Takara Bio). In-Fusion reaction solution was directly used for transformation of TOP10 strain of E ...