Labshake search
Citations for Takara Bio :
301 - 350 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and Shield-1 (TaKaRa, Cat#632189, 1μM) for a period of 4 hours in charcoal stripped FBS containing medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... A431 epithelial carcinoma cells (ATCC; Manassas, VA) and GP2-293 cells (Takara Bio USA; San Jose, CA) were cultured in high glucose DME ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4T1 cells were transduced with a luciferase cDNA cloned into the pQCXIN retroviral expression vector (Takara Bio USA; San Jose, CA), selected with 0.5 mg/ml G418 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The PCR products were subsequently cloned to the pMD19-T vector (TaKaRa) for Sanger sequencing.
-
bioRxiv - Cancer Biology 2024Quote: We applied 5’- and 3’-RACE assays to amplify the full length of tsTE1 transcript from the cRNA of MHCC-97L cells using the SMARTer™ RACE cDNA Amplification Kit (Clontech, Mountain View, CA, USA) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Individual punch biopsies were homogenized in 1 ml RNAiso Plus reagent (DSS Takara Bio India Pvt ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was prepared using PrimeScript cDNA Synthesis Kit (DSS Takara Bio India Pvt ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse transcription was performed using the PrimeScript RT reagent kit (Takara, Japan). The qRT-PCR was conducted using a CFX384 Real-Time PCR System (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.2µM of each primer (Table S4) and SYBR® Premix ExTaqTM (Takara) according to the manufacture instructions ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted using RNAiso Plus reagent (Takara, 9019) and reverse transcribed into cDNA using the Hifair® AdvanceFast One-step RT-gDNA Digestion SuperMix (Yeasen ...
-
bioRxiv - Cell Biology 2024Quote: ... The cDNA was synthesized using a commercial a PrimeScriptTM RT Reagent Kit (Takara, Japan). Then ...
-
bioRxiv - Cell Biology 2024Quote: cDNA was prepared from 48-hour cultured cells using CellAmp Direct Lysis and RT set (Takara Bio, Shiga, Japan, Cat# 3737S/A) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The C119S and C160S DR5 mutants were subsequently cloned into the EcoRI and BamHI sites of pRetroX-TetOne- Puro vector (Clontech, Mountain View, CA, USA). Mutation of the DR5 C94 was produced in the DR5 C81S construct to produce the DR5 C81S/C94S using QuikChange mutagenesis and the following primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Cla I sites 5′ to the BamH I site (Clontech, Mountain View, CA, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... and real-time qPCR experiments were conducted using the SYBR fluorescent dye kit (TaKaRa, Japan). The primers used in this procedure included ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse transcription of total RNA was performed using a two-step kit (TaKaRa, Japan), and real-time qPCR experiments were conducted using the SYBR fluorescent dye kit (TaKaRa ...
-
bioRxiv - Genetics 2024Quote: Libraries for sequencing were prepared using the SMART-Seq® v4 PLUS Kit (Takara/CloneTech) according to the manufacture’s specifications ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA from two replicates of each strain were extracted at about 20 generations after refeeding using RNAiso Plus (TaKaRa, 9108).
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA extracted from the gonads underwent reverse transcription after concentration adjustment with the PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Japan).
-
bioRxiv - Molecular Biology 2024Quote: ... and one μg of RNA was reverse transcribed using a cDNA Reverse Transcription Kit (RR037A, Takara). Final cDNA samples were used then used for quantitative real-time PCR assay by SYBR Green PCR Kit (RR820A ...
-
bioRxiv - Molecular Biology 2024Quote: ... and plasmid DNA was isolated using NucleoSpin® Plasmid (NoLid) kit for miniprep (740499.250; Takara Bio) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplification was performed using the Advantage 2 Polymerase Mix (Clonetech, now Takara Bio USA, Mountain View, CA) and the following primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... Final cDNA samples were used then used for quantitative real-time PCR assay by SYBR Green PCR Kit (RR820A, Takara). Quantitative primers were designed based on the gene sequences by Sangon Biotech ...
-
bioRxiv - Molecular Biology 2024Quote: ... The expression vector was produced by inserting the cDNA encoding the Rhino fragment into pGEX-5X-3 (Cytiva) by Infusion (Takara). The primers used are listed in Supplementary Table 1.
-
bioRxiv - Neuroscience 2024Quote: Mice were anesthetized with isoflurane and perfused intracardially with 1X Phosphate Buffered Saline (PBS) (Takara, Japan) and 4% Paraformaldehyde (PFA ...
-
bioRxiv - Cell Biology 2024Quote: ... and complementary DNA (cDNA) was generated using a PrimeScriptTM RT Reagent Kit (Takara, Japan). Then ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from the liver tissue by using Trizol Reagent (Takara, Japan), and complementary DNA (cDNA ...
-
bioRxiv - Cell Biology 2024Quote: ... qRT-PCR was performed with a SYBR Premix Ex Taq II Kit (Takara, Japan) by a Real-Time System (CFX96 ...
-
bioRxiv - Microbiology 2024Quote: ... 19.5 µl of nuclease-free water (Takara Bio), and 5 µl of the DNA template ...
-
bioRxiv - Microbiology 2024Quote: ... comprising 25 µl of 2x probe qPCR mix (Takara Bio Inc., Otsu, Japan), 0.2 µl each of forward and backward primers (100 µmol l-1 each ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting RNA was used as input for the SMARTer smRNA-Seq Kit for Illumina (Takara Cat# 635030). cDNA libraries were prepared according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Total RNAs from HeLa cells (about 5 x 107 cells/10 cm dish) transfected with scrambled siRNA (si-Ctrl) or si-CDC5L were extracted using RNAiso Plus (Takara, 9109) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2024Quote: ... total RNA was isolated from HeLa cells or flies using RNAiso Plus (Takara, 9109) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2024Quote: ... 7 μg of lentiviral vectors was mixed with a Lenti-X packaging (VSV-G) single shots tube (Clontech) in a final volume of 600 μl for 15 min before the transfection mix was added to subconfluent (80-90% ...
-
bioRxiv - Microbiology 2024Quote: ... placed in 1mL LBP from the NucleoSpin RNA Plus kit (Clontech #740984.250) with silica disruption beads and snap frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... the solubilized membrane fraction gets incubated with TALON SuperFlow resin (Takara 635502) for 1 hours at 4°C and was later washed using buffer B supplemented with 20 mM imidazole ...
-
bioRxiv - Microbiology 2024Quote: Plasmids were introduced into HEK293T cells using the TransIT®-293 (Takara) reagent in six-well plates ...
-
bioRxiv - Microbiology 2024Quote: HEK293T cells were transfected with expression plasmids using the TransIT-293 transfection reagent (Takara, Shiga, Japan), following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... A3 encapsidation was determined by concentrating the virus containing supernatant using Retro-X Concentrator (Clontech) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... PrimeSTAR mutagenesis (Takara), and Gibson assembly ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA samples were treated with recombinant DNase I (TaKaRa). The cDNA was amplified using Premix Ex Taq (Probe qPCR ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized using a PrimeScript II first-strand cDNA synthesis kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The EnvV2-Fca gene was amplified using primers Fe-gvm2Env-F and Fe-gvm2Env-R and detected using probe Fe-gvm2Env-P (containing 6-carboxy-fluorescein; FAM) (Takara). The internal control ...
-
bioRxiv - Microbiology 2024Quote: ... the first strand primer was annealed to 1 µl of sample RNA before being extended with SMARTScribe reverse transcriptase (Clontech). After the addition of the second strand primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lentiviruses were generated by seeding Lenti-X 293T cells (Takara Bio, Cat. No. 632180) in 6-well plates ...
-
bioRxiv - Cell Biology 2024Quote: ... Primary antibodies were diluted using Solution 1 (Takara, NKB-101). Secondary antibodies used for immunoblotting included peroxidase AffiniPure Goat Anti-Rabbit IgG (H+L ...
-
bioRxiv - Molecular Biology 2024Quote: The RBD-DsRed plasmid was created by PCR cloning the HB domain of RNAse H1 into the pDsRed-Express-C1 vector (Clontech), following the previously described method [32].
-
bioRxiv - Cell Biology 2024Quote: ... O’Sullivan and introduced into target plasmids through in-fusion cloning (#638948, Takara Bio). All the target plasmids in this study are derived from a plasmid that contains a CAG promoter for constitutive expression ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1μl PrimeSTAR GXL DNA Polymerase (Takara, #R050B) was made ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4μl dNTP (2.5mM; Takara, #R050B), 1μl Partial R1 – CTACACGACGCTCTTCCGATCT (10μM) ...