Labshake search
Citations for Takara Bio :
651 - 700 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... The amplified DNA fragments were ligated into T vector pMD19 (#3271, Takara), and whose nucleotide sequences in each plasmid clones were determined.
-
bioRxiv - Genetics 2024Quote: ... PCR was conducted as described earlier (section: RNAi-mediated knockdown of Pmtra-2) but using the proofreading PrimeSTAR HS DNA Polymerase (Takara Bio, Shiga, Japan) and Ex Taq DNA Polymerase (Takara Bio ...
-
bioRxiv - Genetics 2024Quote: ... and Ex Taq DNA Polymerase (Takara Bio, Shiga, Japan) respectively in the 1st- and 2nd-round PCR ...
-
bioRxiv - Immunology 2024Quote: ... banked cell pellets were rapidly thawed and processed using the Nucleospin® Blood XL kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... and Ex Taq polymerase (Takara) per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and titer quantified using p24 ELISA antigen assay (Takara). MOI=5 was used to transduce 1x1097 EndoC-βH3 cells in culture media without pen/strep and puromycin.
-
bioRxiv - Genomics 2024Quote: ... were digested and cloned using an Infusion master mix (Takara) upstream of the luciferase gene ...
-
bioRxiv - Genomics 2024Quote: ... Library preparation and HiFi genome sequencing were performed by Takara Bio (Shiga ...
-
bioRxiv - Genomics 2024Quote: Illumina sequencing libraries are prepared by incorporating 1-10 ng of cfDNA with the ThruPLEX® Plasma-seq Kit by Takara Bio ...
-
bioRxiv - Genomics 2024Quote: ... and concentrated to 50x in 1x PBS using Lenti-X Concentrator (Clontech, 631232) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... then concentrated to 50x in 1x PBS using Lenti-X Concentrator (Takara, 631232), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... Virus was concentrated using Lenti-X Concentrator (Takara) and titer quantified using p24 ELISA antigen assay (Takara) ...
-
bioRxiv - Genetics 2024Quote: ... its antibody was removed by stripping buffer (Takara Bio #T7135A) and re-blotted by PKcs antibody to quantify the total amount of DNA-PKcs (See Figures S2I-L).
-
bioRxiv - Immunology 2024Quote: ... 1 ng RNA was used as input to generate cDNA with the SMART-Seq v4 Ultra Low Input RNA Kit (Takara), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... The isolated RNA was RNase III fragmented and adaptor-ligated using PrepX mRNA Library kit (Takara, Mountain View CA), then converted into cDNA using Superscript III reverse transcriptase (Lifetech ...
-
bioRxiv - Genomics 2024Quote: ... The PCR reaction mix consisted of 1.25 PrimeSTAR GXL DNA Polymerase (Takara Bio USA, San Jose, CA), 1× Buffer ...
-
bioRxiv - Genomics 2024Quote: ... Lysates were incubated with His60 Ni Superflow resin (Takara Bio) at 4°C with rotation for 1 hour ...
-
bioRxiv - Genomics 2024Quote: ... were then synthesised by GenScript and initially cloned into pLVX-IRES-ZsGreen1 lentiviral vector (Takara Bio) in frame with an IRES-ZsGreen1 sequence ...
-
bioRxiv - Developmental Biology 2024Quote: ... rabbit anti-DsRED (1:1000; Clontech, Cat # 632496), chicken anti-GFP (1:250 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3.3 mL of Lenti-X concentrator (Takara, cat.# 631231) were added to 10 mL of filtered SN ...
-
bioRxiv - Developmental Biology 2024Quote: ... libraries were prepared by the iGE3 Genomic Platform using the SMART-Seq v4 kit (Clontech, 634893) for the reverse transcription and cDNA amplification ...
-
bioRxiv - Developmental Biology 2024Quote: ... The purified PCR fragments were subsequently cloned into the XbaI-linearized pUASp-K10-attB vector (Koch et al., 2009) via In-Fusion reaction (#639648, Takara Bio, Japan). Plasmids confirmed to be correct were injected into embryos of nos-phiC31;;P{CaryP} attP2 (#25710 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The CDs of cdon was amplified using PCR (Prim STAR Max Premix Takara NO.R045A) and cloned into the vector PCS2+ to generate the expression constructs (5x In-Fusion HD Enzyme Premix ...
-
bioRxiv - Developmental Biology 2024Quote: We used In-Fusion enzyme (Takara Bio, #638947) to create a single nucleotide substitution on the 69th amino acid (Leucine to Stop ...
-
bioRxiv - Cell Biology 2024Quote: ... 1999) with a retroviral vector expressing integrin β1 under a tet-inducible promotor (Retro-X™ Tet-On®; Clontech, USA). Integrin β1-induced and FACS sorted cells were cultured in DMEM with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2024Quote: ... Human embryonic kidney (HEK) cell lines (Lenti-X 293T) (Takara) were cultured in high-glucose DMEM (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... Virus was concentrated with polyethylene glycol (Lenti-X, Takara, #631232). Lentivirus was produced in airway epithelial cell expansion medium supplemented with Y27632 and retinoic acid as described95 ...
-
bioRxiv - Cell Biology 2024Quote: ... p53-TA-Luc (Clontech/Takara) was used to assay p53 transcriptional activity and pRL-CMV (Promega ...
-
bioRxiv - Cell Biology 2024Quote: A plasmid expressing Ub-X-YFP-FLAG was constructed as follows: (1) the pHA-Ub-YFP: YFP moiety of pEYFP-N1 (Clontech, Mountain View, CA, USA) was amplified using PCR with primers HA-Ub-R-YFP f and r ...
-
bioRxiv - Cell Biology 2024Quote: ... Complementary DNA (cDNA) was synthesized using the PrimeScript™ RT reagent Kit with gDNA Eraser Kit (TaKaRa, Japan) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... using SYBR® Premix Ex TaqTM II (TaKaRa, Japan). All primer information for each target gene was obtained from the Primerbank website(https://pga.mgh.harvard.edu/primerbank/) ...
-
bioRxiv - Cell Biology 2024Quote: ... coli total RNA using SMARTer smRNA-Seq Kit for Illumina (Cat# 635029, Takara Bio, Shiga, Japan). Libraries were quality-checked on the Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... and the YFP cDNA was assembled using an In-fusion HD cloning kit (Takara-Bio, Shiga, Japan). (2 ...
-
bioRxiv - Cell Biology 2024Quote: ... and cloned into pCMV-HA-N or pCMV-HA-C (Clontech). Notably ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-DsRed (Takara 632496) at 1:300 ...
-
bioRxiv - Cell Biology 2024Quote: Cells were trypsinized and washed with cold 1X PBS (Takara-#T9181) and fixed with 0.5% PFA for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Western blotting was performed using antibodies against GFP (clone JL8, 63268; Clontech), Y15-phosphorylated Cdk1 (anti-Phospho-cdc2 ...
-
bioRxiv - Cell Biology 2024Quote: All PCRs were performed in 50 µL reactions using ExTaq Polymerase (Takara Bio #RR001B) with the following program:
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were purified using NucleoSpin Gel and PCR Clean-up (TaKara Bio Inc.), and then analyzed and quantified by Nanodrop spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... the Sar1 genome template was first amplified from HeLa genomic DNA with following primers (CCGCTCTAGAACTAGTACCCAAATGAGCTCTGGC, CGGTATCGATAAGCTTGCATCAGTATTAAATACACATG) and cloned into pBSIISK(-) by In-Fusion HD cloning Kit (TAKARA). Next ...
-
bioRxiv - Cell Biology 2024Quote: ... 1×105 cells of HeLa cells or BJ-5ta cells expressing inducible TM-mNG21-10 were transfected with 7.5 pmol of Cas9 (TAKARA), 7.5 pmol of sgRNA ...
-
bioRxiv - Cell Biology 2024Quote: ... The construct was then used as a donor template for ssDNA production by Guide-it Long ssDNA production system v2 (TAKARA). Following primers (GCATCAGTATTAAATACACATG ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA template for sgRNA was generated by PrimeSTAR GXL DNA Polymerase (TAKARA) by overlapping PCR using a set of three primers ...
-
bioRxiv - Cell Biology 2024Quote: ... semiquantitative PCR was performed using 2X EmeraldAmp GT PCR Master Mix (Takara-#RR310) and gene-specific primers and the amplified PCR products were visualized on 2% agarose gel ...
-
bioRxiv - Cell Biology 2024Quote: ... Complementary DNA (cDNA) synthesis was carried out with 1 μg of RNA using the PrimeScript RT reagent kit (Takara-#RR037A-4). The cDNA was diluted and semiquantitative and Real-time PCR techniques were performed ...
-
bioRxiv - Cell Biology 2024Quote: ... and protein concentration was estimated by BCA Kit (Takara-#T9300A). For the assay ...
-
bioRxiv - Cell Biology 2024Quote: RNA was extracted by using RNAiso Plus (Takara-#9109) according to the manufacturer’s instruction and then quantified by Nanodrop One at 260nm (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... qPCR was performed by using TB Green master mix (Takara-#RR820) using gene-specific primers in a 7500 Applied Biosystems Real-time PCR machine ...
-
bioRxiv - Cell Biology 2024Quote: ... or NucleoBond Xtra Midi (TaKaRa Bio Inc., Japan). Each prepared library was interrogated for the presence of potential supF mutants by using the indicator non-SOS induced E ...
-
bioRxiv - Cell Biology 2024Quote: ... Virus titer was measured by using Lenti-X p24 Rapid Titer Kit (Cat #022261, Takara).