Labshake search
Citations for Takara Bio :
2651 - 2700 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... The coding region of PIF4 was amplified and cloned into the yeast GAL4 activation domain (GAL4 AD) of pGADT7-Rec2 (Clontech, CA, USA) prey vector ...
-
bioRxiv - Plant Biology 2023Quote: ... 7.5 μl TB Green Premix Ex Taq II (Tli RNaseH Plus) (Takara). Melting curves were performed to confirm amplification specificity.
-
bioRxiv - Plant Biology 2023Quote: ... were amplified and cloned into pAbAi (Clontech, CA, USA) to generate the bait vectors (Pro-SAL1-AbAi and Pro-NHX1-AbAi) ...
-
bioRxiv - Plant Biology 2023Quote: ... Genomic DNA was removed with DNase I (Takara). cDNA was then reverse transcribed via SuperScript VILO cDNA Synthesis Kit (Invitrogen Life Technologies) ...
-
bioRxiv - Plant Biology 2023Quote: A Y2H library screen was performed as outlined in the Matchmaker Gold “Mate and Plate” Yeast Two-Hybrid System (Takara Bio Inc.) using pGBKT7-CML13 as the bait in yeast strain AH109 ...
-
bioRxiv - Plant Biology 2023Quote: ... an aliquot (100 µL) of transformed cells was then plated onto SD media containing the appropriate dropout supplement (Takara Bio USA, Inc.), and grown at 30°C for up to 7 days.
-
bioRxiv - Plant Biology 2023Quote: RNA samples were extracted with RNAiso Plus (Takara) and cDNA was synthesized from 1000 ng of total RNA using a Hifair® III 1st Strand cDNA Synthesis SuperMix (gDNA digester plus ...
-
bioRxiv - Plant Biology 2023Quote: ... and treated with DNase I (Takara). Libraries for mRNA-seq were constructed using the KAPA Stranded RNA-seq Library Preparation Kit according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The constructs were transformed in the Y2H gold yeast strain by using Yeastmaker Yeast Transformation System (Clontech). For the Y2H assay ...
-
bioRxiv - Systems Biology 2023Quote: ... RORC reporter locus was then amplified with a custom primer (ACACTCTTTCCCTACACGACGCTCTTCCGATCT TGGGGTGATCCAAATACCACC) and sequencing libraries were then prepared with SeqAmp DNA Polymerase (Takara). Libraries were then sequenced on an illumina Hiseq 4000 sequencer.
-
bioRxiv - Microbiology 2023Quote: ... RNase E was then purified using TALON® Metal Affinity Resin (Takara Bio). Protein purity was confirmed by SDS-polyacrylamide gel electrophoresis (PAGE ...
-
bioRxiv - Neuroscience 2023Quote: ... FOXG1 (Takara, Cat#M227), SOX2 (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: pLV-hsynapsin-SRGAP2C-HA-WPRE was generated by insertion of SRGAP2C-HA at a multiple cloning site (MCS) of a pLV-hsynapsin-MCS-WPRE plasmid using InFusion cloning (Clontech, Cat#638909). The MCS was prepared by annealing the following primers pair ...
-
bioRxiv - Neuroscience 2023Quote: 10 ng RNA from each worm sample was used as input for cDNA synthesis using a SMART-Seq v4 Ultra Low Input RNA kit (Takara). Sequencing libraries were prepared from 500 pg of cDNA with a Nextera XT DNA Library Prep kit (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: ... All construct generation was performed by In-Fusion HD cloning kit (638920, Takara).
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (1:200-1:500, Clontech), mouse anti-1D4 anti-Fasciclin II (1:10 ...
-
bioRxiv - Neuroscience 2023Quote: ... Synthesized cDNA was subjected to quantitative PCR using TB Green Fast qPCR Mix (Takara) on the LightCycler system (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-DsRed (1:1000, rabbit; Clontech). Secondary antibodies used were as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... with pEGFP-N1 (Clontech) along with pcDNA3.1 vector encoding WT or mutant PrP ...
-
bioRxiv - Neuroscience 2023Quote: ... and 500 ng total RNA was reverse transcribed using PrimeScript RT Master Mix (Takara). Synthesized cDNA was subjected to quantitative PCR using TB Green Fast qPCR Mix (Takara ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-FOXG1 (1:500, rabbit; Takara), anti-MAP2 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... Green Fluorescent Protein (GFP) antibody (JL-8, 1:500, Clontech), Red Fluorescent Protein Antibody (DsRed ...
-
bioRxiv - Neuroscience 2023Quote: All cells were cultured in high glucose DMEM with 10% Fetal Bovine Serum (tetracycline free, Clontech or Gibco) and penicillin/streptomycin 50units/ml-50 mg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1/3 volume Lenti-X Concentrator (Takara 631232), mixed by gentle inversion ...
-
bioRxiv - Neuroscience 2023Quote: cDNA libraries were prepared using the SMARTer® Stranded Total RNA-Seq Kit v2 – Pico Input Mammalian (Takara Bio) following manufacturer’s instructions in ten batches ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed antibody (Living colors/Takara Bio, RRID: AB_10013483) and mounted in Vectashield (Vector labs ...
-
bioRxiv - Neuroscience 2023Quote: ... guinea pig polyclonal anti-RAX (1:200; M229 Takara Bio Europe Ab, Goteborg, Sweden); rabbit polyclonal anti-activated caspase 3 (AC3 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-mCherry (1:500, Takara Bio, 632496), and guinea pig anti-c-Fos (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by incubation with mouse anti-GFP (1:500, Takara Bio, 632380), rabbit anti-mCherry (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 U/µL TaKaRa RNAse inhibitor (Takara, Shiga, Japan) was added before each experiment ...
-
bioRxiv - Neuroscience 2023Quote: ... the cell body was immediately sucked into the glass electrode with negative pressure and expelled onto a 1.1 µl drop of the ice-cold lysis buffer (0.1% Triton X-100, 2 U/µl TaKaRa RNAse inhibitor ...
-
bioRxiv - Immunology 2023Quote: ... for InFusion cloning (Takara Bio) into the digested Tol2 backbone (F ...
-
bioRxiv - Immunology 2023Quote: ... and then converted to cDNA using PrimeScript™ RT Master Mix (Perfect Real Time, Takara, RR036A). Quantitative real-time reverse transcription-polymerase chain reaction (qPCR ...
-
bioRxiv - Plant Biology 2023Quote: ... The TALON Metal Affinity Resin (Takara, cat. 635501), Pierce Glutathione Agarose (Thermo ...
-
bioRxiv - Plant Biology 2023Quote: ... The resulting fragments were cloned into vector backbones derived from pPY22 (mNeonGreen-Hygromycin B) or pPY23 (mNeonGreen-Nourseothricin) using the In-Fusion Snap Assembly Kit (Takara, cat. 638948). For PpREN knockout ...
-
bioRxiv - Immunology 2023Quote: ... Library construction was performed based on manufacturer’s recommendation for the SMART-Seq® v4 Ultra® Low Input RNA Kit (Takara Bio USA Inc., California, USA) followed by the Nextera® XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: ... using In-Fusion HD EcoDry enzyme (Takara Bio, #638915), following the manufacturer’s instruction.
-
bioRxiv - Immunology 2023Quote: ... Total RNA was normalized prior to oligo-dT capture and cDNA synthesis with SMART-Seq v4 (Takara). The resulting cDNA was quantified using a Qubit 3.0 fluorometer (Life Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... and reverse transcribed into cDNA with PrimeScript RT Master Mix (Takara, RR036A). The real-time polymerase chain reaction was performed using iQ SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... carrying the pGro7 (Takara) plasmid expressing chaperonin proteins GroEL and GroES following an established protocol (Zhang et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... GA-MatryoshCaMP6s was amplified from pRSET B His-GA-MatryoshCaMP6s and subcloned into pDONR /Zeo via In-Fusion cloning (Takara Bio ...
-
bioRxiv - Bioengineering 2023Quote: GA-MatryoshCaMP6s was constructed by replacement of the coding sequence of LSSmOrange in GO-MatryoshCaMP6s with the LSSmApple coding sequence by In-Fusion cloning (Takara) following manufacturer recommendations ...
-
bioRxiv - Neuroscience 2023Quote: ... lysates were centrifuged at 31,000 x g for 45 min at 4°C and the supernatant was mixed with nickel-nitrilotriacetic acid (Ni-NTA) beads (Takara, 635653) at 4°C for 2 h ...
-
bioRxiv - Plant Biology 2023Quote: ... the In-Fusion HD Cloning Kit (Clontech, Mountain View, CA, USA) was used for cloning RiSKC3 into pFL61[GFP] plasmid ...
-
bioRxiv - Plant Biology 2023Quote: ... The reaction medium contained 2 µL of 5× In-Fusion HD Enzyme Premix (Clontech); 1 µL of linearized pFL61[GFP] (∼100 ng) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was reversely transcribed into cDNA by TAKARA PrimeScripttm RT reagent Kit with gDNA Eraser for Reverse transcription ...
-
bioRxiv - Plant Biology 2023Quote: ... and SYBR Premix Ex Taq (Takara) in a total volume of 10 µL ...
-
bioRxiv - Plant Biology 2023Quote: ... One µL of the reaction medium was then used to transform StellarTM competent cells (Clontech). DNA plasmids were sequenced using the service of Eurofins Genomics (Germany).
-
bioRxiv - Plant Biology 2023Quote: ... the Matchmaker Gold Yeast Two-Hybrid System (Clontech) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... the SYBR Green Master Mix (TaKaRa) was used to do the qRT-PCR assays.