Labshake search
Citations for Takara Bio :
2451 - 2500 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... total RNA (0.5 ng) was added to reaction buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara), and reverse transcription was performed followed by PCR amplification to generate full length amplified cDNA ...
-
bioRxiv - Genomics 2024Quote: ... 152 ∗106 GPRTG cells were seeded into a 2-STACK culture chamber (Cornig) and transfected 24 h later with 238 µg transfer plasmid using the CalPhos Mammalian Transfection Kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... coli strain BL21-competent cells (TaKaRa Bio, TKR9126). Colonies were inoculated into LB broth for starter cultures incubated at 37°C overnight ...
-
bioRxiv - Genetics 2024Quote: ... The detailed protocol was described in the manufacturer’s handbook (Yeast protocols handbook; PT3024-1; Clontech).
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/9 particles were purified using the AAV Purification kit (Takara). The AAV solution was concentrated to the optimal volume (up to 100 μL ...
-
bioRxiv - Neuroscience 2024Quote: ... Rabbit-anti-DsRed (TaKaRa 632496, 1:1000 dilution), Rabbit-anti-Pb (Cribbs ...
-
bioRxiv - Neuroscience 2024Quote: The pEGFP-N1 plasmid obtained from Clontech (Mountain View, CA, USA) and CXCR7-Tango plasmid (Flag-tagged ACKR3 ...
-
bioRxiv - Neuroscience 2024Quote: The primary antibodies used were: rabbit anti-dsRed (Living Colors® Clontech, used at 1/1000), rabbit anti-Vangl2 58 ...
-
bioRxiv - Neuroscience 2024Quote: ... Viral supernatants were then concentrated using Lenti-X Concentrator (Takara Bio; Cat # 631232) according to the manufacturer’s protocol and resuspended in 1X CMF PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... All expression plasmids were validated by Sanger DNA sequencing (Azenta Life Sciences) and prepared using Nucleobind Xtra Midi Endotoxin-free prep kits (Takara Cat # 740420.5), following the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2024Quote: ... FOXG1 (Takara, 1:500), SOX10 (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... and incubated overnight at 4°C in with primary antibodies Rabbit-anti-dsRed (1:200, Takara Bio Cat# 632496, RRID:AB_10013483) and Chicken-anti-GFP (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... stripping buffer were purchased from Takara Bio (Kusatsu ...
-
bioRxiv - Immunology 2024Quote: Reverse transcription was performed by using PrimeScript™ RT Reagent Kit (Takara). Quantitative PCR was run using SYBR green Master Mix or TaqMan Fast Advanced Master Mix on a QuantStudio 3 (Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: ... hTRIM21 full-length CDS with N-terminal Myc and EGFP was cloned into pLEX-MCS and transfected into HEK293T-Lenti cells (Clontech 632180) along with pMD.2G and psPAX2 (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... The retroviruses were attached to a dish coated with RetroNectin (TaKaRa, #T100B) to infect the cells.
-
bioRxiv - Molecular Biology 2024Quote: ... joined by In-Fusion® HD Cloning Kit (Takara), consist of EcoRV-NdeI (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... AML cells were infected with the virus-containing medium in the presence of Retronectin (Takara, #T100A), according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lenti-X 293T cells (Clontech) were maintained in high glucose DMEM supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Digested chromatin was allowed to diffuse out of cells at 37 °C for 20 min and DNA was purified by Nucleospin gel and PCR clean-up spin column (Takara bio). Sequencing libraries were prepared using the KAPA HTP Library Preparation Kit (KAPA Biosystems) ...
-
bioRxiv - Immunology 2024Quote: ... and used as a template for qPCR with TB Green® Premix Ex TaqTM II (Tli TNaseJ Plus) (Takara, #RR820L) and the following primers (Eurofins):
-
bioRxiv - Molecular Biology 2024Quote: ... They were then rinsed twice with warm PBS and normal culture medium containing 0.25 µg/ml doxycycline was added to induce CASPEX expression (Clontech #631311). 24 hours later ...
-
bioRxiv - Molecular Biology 2024Quote: ... POINT5-seq libraries were made with the SMARTer Stranded RNA-Seq kit (Takara Bio) protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... the viral supernatant was collected and concentrated using Lenti-X concentrator (Takara) following manufacturers instructions ...
-
bioRxiv - Molecular Biology 2024Quote: Human Embryonic Kidney cells stably expressing the SV40 large T antigen (HEK293T, ATCC) and GP2-293 (Clontech) cells were cultured in complete DMEM (10% FBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... was cloned in-frame into pAcGFP-N1 (Clontech) using NEBuilder HiFi DNA Assembly reaction protocol (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lentivirus transduction vectors were derived from pLVX-puro (Clontech). For β-galactosidase transduction ...
-
bioRxiv - Molecular Biology 2024Quote: ... the pLVX-puro-Xho-ATG-βGal XhoI-XbaI fragment was replaced by the GFP coding region from pEGFP-N1 (Clontech) to yield pLVX-puro-Xho-ATG-EGFP ...
-
bioRxiv - Molecular Biology 2024Quote: ... pEGFP-N1 and pDsRed-N1 were purchased from Clontech and pbeta-Gal expresses the lacZ gene under the CMV-IE promoter ...
-
bioRxiv - Molecular Biology 2024Quote: Plasmids encoding SARS-CoV-2 NSP1 variants were generated by exchanging the EGFP coding sequence of pEGFP-N1 plasmid (Clontech) for the corresponding nsp1 genes ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lentiviruses were generated using 293T-X cells (Takara Bio, USA). Human skin fibroblasts were obtained from a healthy donor or a patient with a pathogenic variant in COQ7 gene ...
-
bioRxiv - Microbiology 2024Quote: ... and shrimp alkaline phosphatase (TaKaRa), and sequenced using the primers 16SA1 and 16SB1 ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed with Gflex (TaKaRa) under the temperature profile of an initial denaturation at 94°C for 1 min followed by 30 cycles of 98°C for 10 s ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed with Ex Taq (TaKaRa) under the temperature profile of an initial denaturation at 95°C for 2 min followed by 35 cycles of 95°C for 30 s ...
-
bioRxiv - Microbiology 2024Quote: ... 5’ and 3’-ends of RBK21 cDNA were analyzed using 5’-Full and 3’-Full RACE core sets (TAKARA) with specific primers (Extended Data Table 8) ...
-
bioRxiv - Physiology 2024Quote: Libraries were prepared by the Van Andel Genomics Core (Grand Rapids, MI) from 1 ng of total RNA using Takara SMART-Seq Stranded Kit (Takara Bio USA, Mountain View, CA) per the manufacturer’s protocol ...
-
bioRxiv - Physiology 2024Quote: ... and ExTaq (Takara, Shiga, Japan). The cycling conditions for the PCR included 30 cycles at 94 °C for 30 seconds ...
-
bioRxiv - Microbiology 2024Quote: ... trizol (Takara Bio) was added to the plate ...
-
Antibodies targeting Crimean-Congo hemorrhagic fever virus GP38 limit vascular leak and viral spreadbioRxiv - Microbiology 2024Quote: ... In-Fusion enzyme (Takara Bio) was used to insert the gBlocks between the secretion signal and the constant region ...
-
bioRxiv - Microbiology 2024Quote: ... as well as into pEGFP-C3 (Clontech Takara, Tokyo, Japan). The plasmid encoding the HCV core protein (amino acids 1-192 ...
-
bioRxiv - Microbiology 2024Quote: ... Yeast cells containing pGBKT7PA28γ were grown in yeast extract-peptone-dextrose medium and transfected with a human foetal brain plasmid library based on pACT2 (Clontech Takara). Clones (22.4 × 106 ...
-
bioRxiv - Microbiology 2024Quote: ... as well as into pEGFP-C3 (Clontech Takara, Tokyo, Japan). The plasmid encoding the HCV core protein (amino acids 1-192 ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized from 1 μg of extracted RNA per sample using the SMARTScribe reverse transcriptase (Clontech) and dT primer (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG T30VN) ...
-
bioRxiv - Molecular Biology 2024Quote: The design procedure and efficacy test of sgRNAs were performed using the CRISPR-P (http://cbi.hzau.edu.cn/cgi-bin/CRISPR) tool and the Guide-itTM sgRNA In vitro Transcription and Screening System (Takara, Mountain View, CA, USA) according to the manufacturer ...
-
bioRxiv - Plant Biology 2024Quote: ... using the SYBR Premix Ex Taq (Tli RNaseH, Takara, Clontech). Expression levels were normalized to a putative initiation factor LalbEIF-4 (Lalb_Chr07g0195211 ...
-
bioRxiv - Plant Biology 2024Quote: ... using the SYBR Premix Ex Taq (Tli RNaseH, Takara, Clontech). Expression levels were normalized to a putative initiation factor LalbEIF-4 (Lalb_Chr07g0195211 ...
-
GIBBERELLIN SIGNALING THROUGH RGA SUPPRESSES GCN5 EFFECT ON STAMEN ELONGATION OF ARABIDOPSIS FLOWERSbioRxiv - Plant Biology 2024Quote: ... The enzyme ExTaq DNA polymerase (Takara, Japan) was used with the primers listed in Supplemental Table S4 to confirm the double mutants ...
-
bioRxiv - Plant Biology 2024Quote: ... Amplification of bisulfite converted DNA was performed using the TaKaRa EpiTaqTM HS (Takara), and the resulting PCR reactions were cleaned-up using the NucleoSpin Gel and PCR Clean-up XS kit (Macherey-Nagel) ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNAs were synthesized using PrimeScript RT Kit with gDNA Eraser (Perfect Real Time; Takara) following the protocol of the manufacturer ...
-
bioRxiv - Immunology 2024Quote: ... qPCR was performed using TB Green PCR Master Mix (RR820, Takara Bio) with the StepOnePlus Real-Time PCR System (Thermo Fisher Scientific ...