Labshake search
Citations for Takara Bio :
2251 - 2300 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... The resulting supernatant was supplemented with 0.3 mL pre-equilibrated His60 Ni superflow resin (Takara Bio) and 20 mM imidazole and the resulting mixture was stirred for 30 min at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: We cloned the DNA damage reporter plasmid with the Gibson assembly method (39) using In- Fusion Snap Assembly Master Mix (Takara, cat# 638947). In a single assembly reaction ...
-
bioRxiv - Microbiology 2024Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described (51) ...
-
bioRxiv - Microbiology 2024Quote: ... to permit In-Fusion (TaKaRa) cloning of the resulting etpBA amplicon bearing a truncated etpA gene into pBAD/myc-His B digested with NcoI/HindIII ...
-
bioRxiv - Bioengineering 2024Quote: ... the RT-PCR reaction was performed in 20 μL of reaction buffer containing 10 μL of TB green Premix Ex Taq II (RR82WR; Takara), 1 μL of 10 μM forward primer ...
-
bioRxiv - Immunology 2024Quote: ... Complementary oligonucleotides with overhangs were annealed and cloned into the BbsI-digested U6b vector using a DNA ligation kit (Takara Bio, 6023). Sense strand:TTCGGAAGTGCCAATCATCACCTC ...
-
bioRxiv - Immunology 2024Quote: ... version 2 (Takara cat. no. 634411). After sequencing ...
-
High-resolution chromosome-level genome provides molecular insights into adaptive evolution in crabsbioRxiv - Genomics 2024Quote: ... the RNA samples underwent treatment with RQ1 RNase-Free DNase (Takara Co. Ltd.) to eradicate genomic DNA contamination ...
-
bioRxiv - Immunology 2024Quote: ... Library preparation and sequencing after tissue fixation were performed by Takara Bio Inc.
-
High-resolution chromosome-level genome provides molecular insights into adaptive evolution in crabsbioRxiv - Genomics 2024Quote: ... using the DNA Ligation Kit Mighty Mix (Takara, Japan). The resulting plasmid constructs ...
-
High-resolution chromosome-level genome provides molecular insights into adaptive evolution in crabsbioRxiv - Genomics 2024Quote: ... The total RNA extraction was extracted using the RNAiso Plus kit (Takara Co. Ltd., Japan). Preceding the quantitative real-time polymerase chain reaction (qRT-PCR) ...
-
bioRxiv - Immunology 2024Quote: ... sfGFP-3×P3-DsRed and homology arms were PCR-amplified using PrimeSTAR® Max DNA Polymerase (Takara Bio, R045). Primers for PCR were designed using the NEBuilder Assembly Tool ...
-
bioRxiv - Microbiology 2024Quote: cDNA synthesis was performed with TAKARA PrimerScriptTM 1st Strand cDNA Synthesis Kit (TAKARA, Dalian, China), following manufacturer instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... qRT-PCR was performed using Takara SYBR Premix Ex Taq (Takara Bio) on Biorad CFX connect real-time system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Four commercial samples (purchased from Ambion, Clontech and Takara companies) of pooled human brain (HB ...
-
bioRxiv - Cancer Biology 2024Quote: Viruses were prepared using the 293T cell line (Clontech, USA) transfected with the appropriate expression vector along with packaging plasmids(ΔR ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was synthesized using the PrimeScript RT Reagent Kit (Clontech, #RR037B). Quantitative PCR was performed in triplicate with 30 ng of cDNA using the Powerup SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... Four commercial samples (purchased from Ambion, Clontech and Takara companies) of pooled human brain (HB ...
-
bioRxiv - Cancer Biology 2024Quote: ... about 200-bp genomic sequences surrounding each sgRNA-targeted site were amplified using specific primers by PrimeSTAR® GXL Premix (TAKARA, #R051A), followed by NGS analysis on Illumina HiSeq X TEN platform ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time qPCR was performed using TB Green Premix Ex Taq II (TaKaRa, #RR820A) on Roche LightCycler480 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sequencing was performed using SMARTer chemistry (SMARTer Ultra Low RNA Kit for the Fluidigm C1 System, Clontech 634835/634935) (three retinae ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 LR cells) were individually re-amplified using the 5’ PCR Primer II A with CloneAmp HiFi PCR Premix (Clontech Laboratories ...
-
bioRxiv - Genomics 2024Quote: ... RNase inhibitor (0.4 U/µl; Takara, 2313B), SUPERase·In (0.2 U/µl ...
-
bioRxiv - Genomics 2024Quote: ... and RNase inhibitor (0.2 U/µl; Takara, 2313B)) and incubated on ice for 15 min ...
-
bioRxiv - Genomics 2024Quote: Synthetic gRNAs (1-2ng) were sequenced by SMARTer smRNA-seq kit from Takara (Cat #635030). Original oligo-dT protocol is modified and first cDNA was synthesized directly with 1µl of tailed scaffold primer (10µM ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sequencing libraries were prepared using SMARTer Stranded Total RNA-seq Kit v2 – Pico Input Mammalian kit (Takara Bio USA, Cat.# 634411) and following the user manual (Rev ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sample tubes were reverse transcribed and amplified using the SMART-Seq V4 Ultra Low Input RNA Kit (Takara Bio 634891) in 10x reduced volume reactions using a Mantis liquid handling system (Lee et al ...
-
bioRxiv - Developmental Biology 2024Quote: ... Using In-Fusion (Takara Bio) the His-Max tag was removed to produce full-length NRL expression plasmid pCDNA4-C-EF1a-FL-NRL (primers #1,2) ...
-
bioRxiv - Developmental Biology 2024Quote: ... were individually re-amplified using the 5’ PCR Primer II A with CloneAmp HiFi PCR Premix (Clontech Laboratories, Inc. A Takara Bio Company, #639298) by heating to 98°C x 2 min followed by 20 cycles of 98°C x 10 s ...
-
bioRxiv - Cell Biology 2024Quote: ... The long (Tm2) and short (Tm4) human isoforms were ligated into the pIRES2-AcGFP1 expression vector (Clontech).
-
bioRxiv - Cell Biology 2024Quote: RNA isolation was performed using TRIzol (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... The expression profile of all genes of interest was evaluated using RT primers by using SYBR green mix (Takara) in a Biorad Real-Time PCR machine ...
-
bioRxiv - Cell Biology 2024Quote: ... Further cDNA was prepared by using a cDNA synthesis kit (Takara) as per the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... DNA fragments were amplified using PCR using PrimeSTAR® Max DNA Polymerase (Takara Biomedical Technology (Beijing) Co. ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli DH5α (Takara Bio. Tech.) was used for molecular cloning to construct plasmids ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Lenti-X Concentrator (Takara Bio, 631232) was added in a 3 parts media ...
-
bioRxiv - Synthetic Biology 2024Quote: Initial testing used four DNA polymerases: LA Taq Hot Start (TaKaRa, Shiga Japan), Herculase II (Agilent ...
-
bioRxiv - Systems Biology 2024Quote: ... Mir-X miRNA qRT-PCR TB Green kit (Takara BIO, San Jose, CA, USA) was used for cDNA synthesis and miRNA expression analysis ...
-
bioRxiv - Molecular Biology 2024Quote: ... rat AT1 and RlucII were subcloned into the pLVSIN-CMV Neo vector (Takara Bio, Japan). Next ...
-
bioRxiv - Molecular Biology 2024Quote: ... sites flanking gene-specific nucleotides and cloned first into an entry vector pDONR207 and then into destination yeast two-hybrid vectors pGADT7 or pGBKT7 (Clontech, Takara Bio USA) using Gateway cloning kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... sites flanking gene-specific nucleotides and cloned first into an entry vector pDONR207 and then into destination yeast two-hybrid vectors pGADT7 or pGBKT7 (Clontech, Takara Bio USA) using Gateway cloning kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... Yeast strain AH109 (Clontech, Takara Bio USA) was used for yeast two-hybrid interaction studies as a tester strain ...
-
bioRxiv - Microbiology 2024Quote: The 500 bp of DNA upstream and downstream of a target gene were amplified by PCR (Primestar Max DNA Polymerase, Takara). The two 500 bp fragments were then fused by overlapping PCR ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized from RNA (approximately 2 μg) with oligo(dT) primers according to the instructions of the PrimeScript First Strand cDNA Synthesis Kit (Takara).
-
bioRxiv - Plant Biology 2024Quote: ... with the SYBR Premix Ex-Taq Kit (Takara). EF-1α (AT1G18070 ...
-
bioRxiv - Neuroscience 2024Quote: ... Confluent HEK293 cells were transfected using a mixture of 50 μl of Opti-MEM I containing a total of 0.9 μg of cDNA constructs encoding hGluN1/hGluN2 subunits and GFP (for identification of successfully transfected cells; pQBI 25, Takara) in a 1:1:1 ratio ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative PCR (qPCR) reactions were performed in triplicate using SYBR master mix (Takara), following the manufacturer’s guidelines ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cultures were supplemented with 0.5 μg·ml−1 anhydrotetracycline (aTc) (Clontech, Mountain View, CA) and 1 mM neuraminic acid (Neu5Ac ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cultures were induced with 0.5 μg·ml−1 anhydrotetracycline (aTc) (Clontech, Mountain View, CA). When experimental conditions required it ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 500 uL of Elution Buffer (Takara) was then added to the column to elute the TdT into a clean 1.5 mL tube ...