Labshake search
Citations for Takara Bio :
1751 - 1800 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C in a vertical rotating mixer (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... 10% tet-approved fetal bovine serum (tet-FBS) (Takara/Clontech, #631367), N2 (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... Hippocampal neurons were transfected on DIV11-13 using the CalPhos Mammalian Transfection kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... respectively) were inserted into the KpnI and XbaI sites of the vector using the In-Fusion HD Cloning Kit (TaKaRa).
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was used to synthesize cDNA using the SMART-Seq v4 full-length transcriptome analysis kit from Takara (product # 634888) using protocol B specified in the manual on page 12 ...
-
bioRxiv - Zoology 2024Quote: ... PCR products were resolved by agarose gel electrophoresis with a DL2000 DNA Ladder (TaKaRa Bio, Dalian, China) before bands of the expected sizes were excised to remove primer dimers ...
-
bioRxiv - Neuroscience 2024Quote: ... The cDNA was synthesized using Prime Script reagent kit (Takara #RR047A). Quantitative PCR was performed on Thermo Piko Real 96 (Thermo ...
-
bioRxiv - Molecular Biology 2024Quote: ... an anti-mCherry antibody (#Z2496N, TaKaRa), or a horseradish peroxidase-conjugated anti-α-tubulin antibody (#HRP-66031 ...
-
bioRxiv - Microbiology 2024Quote: ... HA was purified by passage over TALON Metal Affinity Resin (Takara) followed by gel filtration chromatography on Superdex 200 (GE Healthcare ...
-
bioRxiv - Microbiology 2024Quote: ... Fabs were purified by passage over TALON Metal Affinity Resin (Takara) followed by gel filtration chromatography on Superdex 200 (GE Healthcare ...
-
bioRxiv - Cancer Biology 2024Quote: ... and genomic DNA amplification was carried out using the PicoPLEX Single Cell WGA kit v3 (Takara) and following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The TOB1-AS1 overexpression plasmid was amplified by transforming Stellar™ Competent Cells (Takara, 636763) with the plasmid as per instructions and isolated by QIAGEN HiSpeed Plasmid Midi Kit (QIAGEN ...
-
bioRxiv - Cancer Biology 2024Quote: ... Genomic DNA samples from the patients’s paired tumor tissues and WBCs were used to prepare DNA libraries for DNA sequencing with the ThruPLEX Tag-seq Kit (Takara Bio, USA). The libraries were then pooled and hybridized with pre-designed probes for 95 targeted genes (Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... mRNA was utilized with the SMARTer Human TCR a/b Profiling Kit v2 (Takara, USA). The resulting libraries were sequenced for paired-end reads of 2×250 bp on an Illumina system at a sequencing depth of 7.5X.
-
bioRxiv - Bioengineering 2024Quote: ... The rituximab and cetuximab antibody variable sequences were generated by IDT and cloned into the variable regions of the VRC01 antibody plasmid vector (a generous gift from the Kim lab at Stanford) by using the In-Fusion cloning kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were transiently transfected with plasmids containing receptors of interest under eukaryotic expression promoters (ASGR1 was clone OHU03658D from GenScript, negative control pAMCyan1 from Takara), then split into 96-well plates (20,000 cells per well ...
-
bioRxiv - Neuroscience 2024Quote: ... Total RNA was isolated from samples using the RNAiso Plus (TAKARA, Japan). Detailed protocols were described in Supplementary Methods ...
-
bioRxiv - Neuroscience 2024Quote: ... Quantitative real-time RT-PCR was performed with TB Green® Premix Ex Taq™ II (TAKARA, Japan) using a Bio-Rad CFX 96 real-time PCR detection system (Bio-Rad ...
-
bioRxiv - Neuroscience 2024Quote: Nanobody sequences were amplified by PCR with the specific primers (NbFt-F: gcaagatctgccaccatggcc CAGGTGCAGCTGCAGGAG; NbFt-R:gcaaagcttggatccAGCGTAATCTGGAACATCGTATGGGTA tgcggccgctgagga) and subcloned into the retroviral vector pMSCV (Clontech, Takara Bio, US). HEK-293T cells were grown in 10cm plates and co-transfected with plasmids expressing GFP-mFerritin and anti-ferritin nanobody clones using PEI (DNA:PEI=1:3) ...
-
bioRxiv - Biochemistry 2024Quote: ... and cloned into linearized pUC19 by In-Fusion cloning (Takara Bio). To construct the TPS1IDDΔ strain ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA from each candidate cell line was digested to single nucleosides using nuclease P1 (Fujifilm Wako Pure Chemical Corporation) and bacterial alkaline phosphatase (TaKaRa), followed by mass spectrometry analysis ...
-
bioRxiv - Biophysics 2024Quote: ... Biosensor expression was regulated by tetracycline-inducible expression system (tet-OFF: Clontech) and stably traduced using a retrovirus(72) ...
-
bioRxiv - Biophysics 2024Quote: ... Insoluble material was then removed by centrifugation at 50k x g for 30 min and Talon resin (Clontech) with 20 mM imidazole overnight binding at 4 °C ...
-
bioRxiv - Biophysics 2024Quote: ... The concentration of purified proteins was determined by the Bradford method using TaKaRa Bradford Protein Assay Kit (Takara Bio, T9310A).
-
bioRxiv - Biophysics 2024Quote: ... the solution of carboxylated beads was diluted into 400 µL of 1× Phosphate-Buffered Saline (PBS) (Takara Bio, T900) containing 100 mg/mL PLL-g-PEG (SuSoS ...
-
bioRxiv - Cancer Biology 2024Quote: ... 293T cells at 50-70% confluency were transfected with 755 ng plasmid DNA using Xfect Transfection Reagent (Clontech Laboratories, #631317) in 24-well plates according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... we used Tet-Free FBS (Takara cat. 631106).
-
bioRxiv - Cell Biology 2024Quote: ... primary beta cells were transduced with phogrin cDNA ligated with pEGFP-N1 vector (Clontech), treated successively with Ins1 media containing 2 mM and 20 mM glucose respectively for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... pEYFP-C1 or pECFP-C1 vectors (Clontech). The expression vectors were transduced into primary islet cells using the ViraPower Adenoviral Expression System (Thermo Fisher ...
-
bioRxiv - Cell Biology 2024Quote: ... The DCC-GFP D1290N mutant plasmid was generated by point mutation (GAC to AAC oligo CCAA-CACTCTCAGTGAACCGAGGTTTCGGAG ; Infusion, Clontech).
-
bioRxiv - Cell Biology 2024Quote: ... GlycoM and RGE were generated by PCR of FL using oligonucleotides with mismatch according to inFusion point-mutation protocol (Clontech). For the glycoM plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... or the 6X-TRE-luciferase reporter (6X-TRE-luc; Clontech) to analyze AP-1 activity (Sabatakos et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... employing the CalPhos mammalian transfection kit (Takara Bio). Supernatants were harvested at 48 and 72 h post-transfection and subsequently stored at −80°C.
-
bioRxiv - Microbiology 2024Quote: ... Using the PrimeScript first strand cDNA synthesis kit (Takara, cat no- #6110A), the first strand of cDNA was synthesised according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... or PrimeScript RTase (TaKaRa). TaqMan RT-PCR primers for NEP1R1 ...
-
bioRxiv - Cell Biology 2024Quote: Lentiviral particles were generated using the pLVX system (Clontech) with packaging vectors psPAX2 and pMD2.G (Addgene plasmids #12260 and #12259) ...
-
bioRxiv - Cell Biology 2024Quote: ... the first strand cDNA was prepared using PrimeScript II 1st Strand cDNA Synthesis Kit (Takara, Beijing, China).
-
Emerging cooperativity between Oct4 and Sox2 governs the pluripotency network in mouse early embryosbioRxiv - Developmental Biology 2024Quote: ... cDNA was amplified with V3d(T)24 and R2SP primers and Terra PCR Direct Polymerase (Clontech) for 16 cycles ...
-
bioRxiv - Cell Biology 2024Quote: ... Retroviruses with the vesicular stomatitis virus–G (VSV-G) envelope were produced by transfection of GP2-293 cells (Clontech) with the pRetroX construct and pVSV-G (Clontech ...
-
bioRxiv - Cell Biology 2024Quote: ... and pmCherry-C1 (Takara Bio) for Ca2+ imaging and immunocytochemical analyses ...
-
bioRxiv - Cell Biology 2024Quote: ... a DNA cassette containing the miRNA sequence was subcloned and inserted into pEBFP-C1 (Takara Bio) and pmCherry-C1 (Takara Bio ...
-
bioRxiv - Microbiology 2024Quote: ... Genomes in the cell lysate were digested by 600U/mL of HindIII (Takara Bio, Shiga, Japan) for 4 hours at 37°C ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was isolated at specific time points post infection by using TRIzol (Takara) as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was isolated at specific timepoints post-infection by using TRIzol (Takara) as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... dNTPs and reverse transcriptase (Takara) as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... The expression profile of target gene was evaluated using specific primers and SYBR green RT-PCR master mix (Takara) in BioRad Real-time PCR instrument ...
-
bioRxiv - Cell Biology 2024Quote: ... The concentration of the purified protein was assessed by densitometry using bovine serum albumin (TaKaRa, cat. # T9310A) as a standard following SDS-PAGE and staining with the Q-stain ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR with Advantage 2 (Takara 639207). 5 µL of ligation sample ...
-
bioRxiv - Cell Biology 2024Quote: ... The cDNA for p53 WT was cloned into pRetroX-IRES-ZsGreen1 (Clontech). The cDNA for p53 WT or p53 QM was cloned together with the DNA sequence for an NH2-terminal FLAG tag into pRetroX-Tight-Pur (Clontech) ...
-
bioRxiv - Cell Biology 2024Quote: ... The cDNA for p53 WT or p53 QM was cloned together with the DNA sequence for an NH2-terminal FLAG tag into pRetroX-Tight-Pur (Clontech). Retroviruses with the vesicular stomatitis virus–G (VSV-G ...