Labshake search
Citations for Takara Bio :
1651 - 1700 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: Total RNAs were extracted using RNAiso Plus reagent (Takara) and cDNA was synthesized using PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time ...
-
bioRxiv - Biophysics 2024Quote: ... The resulting product was separated on a 0.75 % agarose gel and the 11.6-kb dsRNA was excised and purified using Agarose Gel DNA Extraction Kit (Takara).
-
bioRxiv - Biophysics 2024Quote: ... and TALON cobalt affinity resin (Takara), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... coli Rosetta competent cells (TaKaRa) and used for the expression and purification of recombinant GST-Rbp3 protein as follows ...
-
bioRxiv - Microbiology 2024Quote: ... coli and purified using either Talon cobalt resin (Clontech) or HisPur cobalt resin (ThermoFisher) ...
-
bioRxiv - Microbiology 2024Quote: ... PCR product was inserted into the plasmid pACYC184 digested using BamHI and EagI by infusion cloning (Clontech, USA), as reported previously (56) ...
-
bioRxiv - Genomics 2024Quote: ... the first PCR was performed using a Multiplex PCR Assay Kit Ver.2 (Takara) with MIG-seq primer set-1 developed by Suyama and Matsuki (2015) ...
-
bioRxiv - Genomics 2024Quote: ... which was performed with PrimeSTAR GXL DNA Polymerase (Takara) following the PCR program of Nishimura et al ...
-
bioRxiv - Genomics 2024Quote: ... RNase inhibitor (0.4 U/µl; Takara, 2313B), SUPERase·In (0.2 U/µl ...
-
bioRxiv - Molecular Biology 2024Quote: ... Yeast strain AH109 (Clontech, Takara Bio USA) was used for yeast two-hybrid interaction studies as a tester strain ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Lenti-X 293T (Takara 632180) cells were maintained in DMEM ...
-
bioRxiv - Genetics 2024Quote: ... or anti-Myc (9E10, Takara Bio) antibodies coated to Protein A Dynabeads (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... albopictus promoter from AALFPA_045636 and by introducing XbaI restriction sites using In-Fusion cloning (Takara) on four fragments amplified using the primers in Table S2 ...
-
bioRxiv - Neuroscience 2024Quote: ... using SMARTer Ultra Low Input kit (634940, Takara Bio/Clontech). All samples were sequenced in parallel at two different time points using Illumina NovaSeq 6000 flow cell and fastq files have been deposited on the Gene Expression Omnibus (GEO ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was generated from total RNA using the Prime Script reagent kit (Takara #RR047A). Candidates of ΔPtth were characterized by the loss of DNA band in the deleted areas through PCR on the genomic DNA and cDNA ...
-
bioRxiv - Neuroscience 2024Quote: ... Quantitative PCR was performed on Thermo Piko Real 96 (Thermo) using SYBR Green PCR Master Mix (Takara #RR820A). The mRNA expression level was calculated by the 2−ΔΔCt method and the results were plotted by using tubulin as the reference gene ...
-
bioRxiv - Neuroscience 2024Quote: ... a PGK promoter-driven mCherry expression cassette and the WPRE element were inserted into pMSCV (Clontech, Takara Bio) at the XhoI and ClaI sites to generate an empty vector (pMSCV-mCherry-WPRE) ...
-
bioRxiv - Neuroscience 2024Quote: Nanobody sequences were amplified by PCR with the specific primers (NbFt-F: gcaagatctgccaccatggcc CAGGTGCAGCTGCAGGAG; NbFt-R:gcaaagcttggatccAGCGTAATCTGGAACATCGTATGGGTA tgcggccgctgagga) and subcloned into the retroviral vector pMSCV (Clontech, Takara Bio, US). HEK-293T cells were grown in 10cm plates and co-transfected with plasmids expressing GFP-mFerritin and anti-ferritin nanobody clones using PEI (DNA:PEI=1:3) ...
-
bioRxiv - Systems Biology 2024Quote: ... Ligated plasmid products were transformed into stellar competent cells (E. coli HST08 strain, Takara Bio). See Dataset EV1 for full descriptions of constructs.
-
bioRxiv - Systems Biology 2024Quote: The pool of duplets was ligated to each of the barcoded promoter vectors using Takara ligation kit version 2.1 (#6022; Takara). Ligation products were purified using magnetic bead purification and 2 µl of the ligation were electroporated into 20 µl of electrocompetent e ...
-
bioRxiv - Plant Biology 2024Quote: ... A volume of 2 µg of total RNA was reverse transcribed into single-stranded cDNA using AMV reverse transcriptase (TaKaRa, Dalian, China). The primer sequences used for qRT-PCR are listed in Supplementary file 1b ...
-
bioRxiv - Cell Biology 2024Quote: Lentiviruses were produced by co-transfection of 293T cells (Takara, #632180) with lentiviral backbone constructs and packaging vectors (psPAX2 and pMD2.G ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA synthesis was conducted using RNA to cDNA EcoDry™ Premix (Oligo dT) (Takara). Real-time quantitative PCR (RT-qPCR ...
-
bioRxiv - Cell Biology 2024Quote: ... The rabbit polyclonal antibody against GFP was from Takara Bio Inc (Catalog number ...
-
bioRxiv - Systems Biology 2024Quote: ... SMART-Seq V4 Plus kit (Cat# R400753) was purchased from Takara Bio USA.
-
bioRxiv - Cell Biology 2024Quote: ... HEK-293T cells (Clontech) were grown in DMEM (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... mCherry (Clontech), pmRFP-LC3 (Addgene #21075 ...
-
bioRxiv - Biochemistry 2024Quote: ... 20 ng of total RNA was used as input for the SMART-Seq v4 Ultra Low Input RNA kit (Takara Bio USA. Inc), which converts poly(A ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell-spotted nanowell chips are covered with SmartChip Intermediate Film (Takara 430-000104-10) and stored at -20°C until library construction.
-
bioRxiv - Cell Biology 2024Quote: ... Some constructs were ligated using In-Fusion Cloning (Takara Bio). Details of primer sets ...
-
bioRxiv - Microbiology 2024Quote: ... Full-length cDNA was generated using the SMART-Seq® HT Kit (Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... LA Taq DNA Polymerase (Takara RR002C) was utilized for PCR amplification of targeted genes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viral supernatants were collected and concentrated with a Lenti-X concentrator (Takara) and stored at –80°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Restriction enzymes were from Takara Bio (Lab Supplies Scientific SA ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA unique Dual index kit was used to combine libraries for sequencing (Takara Bio Inc, USA). NOVASEQ 3000 was used for sequencing at the NIBMG core facility (COTERI ...
-
bioRxiv - Cancer Biology 2024Quote: ... a sequencing library was made using 1 ng of sheared cDNA using Low Input Library Prep Kit v2 (Takara Bio Inc, USA). DNA unique Dual index kit was used to combine libraries for sequencing (Takara Bio Inc ...
-
bioRxiv - Cancer Biology 2024Quote: ... and cDNA was synthesized from 1 μg RNA using PrimeScriptTM RT Master Mix kit (Takara, Cat#RR036A) following the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293T-Lenti-X cells (Takara Bio) were thawed ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the SuperPlex Premix PCR master mix (Takara, Otsu, Shiga, Japan). PCR1 ...
-
bioRxiv - Cell Biology 2024Quote: ... and the presence of ΔTM-VezA-GFP was confirmed by western blotting analysis with a mouse monoclonal anti-GFP antibody from Clontech. In addition ...
-
bioRxiv - Cell Biology 2024Quote: ... Viral particles were collected and concentrated using Lenti-X Concentrator (Clontech) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by reverse transcription using PrimeScript™ RT Master Mix (Takara, cat. no. RR036A) per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... in 1:200 dilution and mouse monoclonal anti-mCherry antibody (Takara, 632543) in a 1:400 dilution at 4°C on rocker ...
-
bioRxiv - Developmental Biology 2024Quote: ... For posterior lineage analysis rabbit-anti-dsRed (Takara, 632496) and goat-anti-SOX9 (R&D ...
-
bioRxiv - Developmental Biology 2024Quote: ... libraries were prepared using the SMART-Seq® Stranded Kit (TaKaRa Bio Inc. Shiga, Japan). The libraries were sequenced on NovaSeq6000 with cycles of 51+8+8+51.
-
bioRxiv - Developmental Biology 2024Quote: ... single-strand cDNA generated with the cDNA synthesis kit (Takara, Otsu, Japan) was performed ...
-
bioRxiv - Developmental Biology 2024Quote: ... The qPCR was performed using SYBR Premix Ex Taq (Takara, Osaka, Japan). The reaction was carried out on the CFX96 Real-time Detection System (Bio-Rad ...
-
bioRxiv - Genetics 2024Quote: ... Whereafter 1μg of RNA was reverse-transcribed using the PrimeScript RT Reagent Kit (TAKARA, Japan). The cDNA was diluted to a comparable concentration and then used for RT–PCR ...
-
bioRxiv - Genetics 2024Quote: ... total RNA was extracted from mouse tissues using TRIzol reagent (TAKARA, Japan). Whereafter 1μg of RNA was reverse-transcribed using the PrimeScript RT Reagent Kit (TAKARA ...
-
bioRxiv - Genetics 2024Quote: ... was developed using the SMART cDNA Library Construction Kit (Clontech, Code No.634901) as described by He et al. ...