Labshake search
Citations for Takara Bio :
1651 - 1700 of 2391 citations for PCR Tube since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR reaction mixture (10 μl total volume) included 5 μl SYBR Premix Ex Taq II (TaKaRa, Dalian, China), 3.5 μl ddH2O ...
-
bioRxiv - Immunology 2021Quote: ... and one deletion mutant Δ39-59 were made by mutation PCR with PrimerSTAR Max DNA Polymerase (Takara, Beijing, China) and pdsRed-p17 as the template ...
-
bioRxiv - Plant Biology 2020Quote: ... This was followed by a nested PCR and cloning of the products using the Mighty TA-cloning kit (TaKaRa). Twenty independent clones were randomly picked and sequenced.
-
bioRxiv - Microbiology 2021Quote: ... The PCR product of the assembled sequence was purified with a DNA Fragment Purification Kit (Takara, Dalian of China) and eluted with ddH2O ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA extraction from NSC cultures for qRT-PCR and RNAseq analysis was done using NucleoSpin® RNA (Takara) and Trizol (Thermofisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR (qPCR) was conducted using TB GreenTM Premix Ex TaqTM (Tli RNaseH Plus) according to the manufacturer’s protocol (Takara). The primers used for qPCR were 5’-ACCATTGTGGACACACCAGG-3’ and 5’-GAACCTGTGACCACCTGCTA-3’ for human ARTS ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA was subjected to quantitative SYBR Green real-time PCR by using SYBR Premix Ex Taq II (Takara Bio). A list of the specific primers used is shown in Table 3 ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using 1–2 μL of the genomic DNA solution and Tks Gflex DNA polymerase (Takara Bio). The primers are listed in Table S3 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were originally obtained from the ATCC and routinely tested negative for mycoplasma contamination (PCR Mycoplasma Detection Set, Takara).
-
bioRxiv - Neuroscience 2020Quote: Total RNA extraction from OL cultures for qRT-PCR and RNAseq analysis was done using NucleoSpin® RNA (Takara) and Trizol (Thermofisher ...
-
bioRxiv - Microbiology 2021Quote: ... The regions of the expression plasmids containing the entire inserts were PCR amplified using PrimeSTAR GXL Polymerase (Takara, Japan) and Nanopore_pCMV_F and Nanopore_BGH_R primers (Supplementary table 7) ...
-
bioRxiv - Molecular Biology 2020Quote: ... at 50°C for 1hr followed by incubation with 0.5U/μL T4 RNase H at 37°C.The libraries were generated by PCR using LA Takara taq polymerase (Clontech) and oligos P5 and PE (see Table S1 ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μL of 10 × PCR Buffer (Mg2+ plus) provided with the TAKARA Taq™ Hot Start Version (TAKARA, Japan), 0.08 μL of TransScript® Reverse Transcriptase [M-MLV ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA samples were subjected to real-time PCR with SYBR Premix Ex Taq Tli RNase H Plus (Takara) using an ABI 7500 Fast Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... Two-step PCR-amplification and sequencing library preparation was conducted with TaKaRa Ex Taq™ Polymerase (TaKara, Cat. RR001) and custom primers to achieve adequate sequencing coverage in 1×75bp single-end reads ...
-
bioRxiv - Cell Biology 2021Quote: Point mutation primers were designed (Table S1) for PCR using 42B3-scFv as a template with Prime STAR (TaKaRa). KOD one PCR Master Mix Blue (Toyobo ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized using a PrimeScript II High Fidelity One Step RT-PCR Kit (R026A, Takara Bio, Shiga, Japan), purified using a QIAquick PCR Purification Kit (QIAGEN ...
-
bioRxiv - Cell Biology 2021Quote: WIPI3-HA construct used for expression in mammalian cells (pJC248): a gBlock (IDT) encoding WIPI3-HA was assembled by Gibson cloning with PCR amplified pcDNA3.1+ (Clontech). ss-HA-CPD in pEGFP_N1 (pJC338) ...
-
bioRxiv - Molecular Biology 2022Quote: ... qRT-PCR was carried out by using TB Green Premix Ex Taq II (Tli RNaseH Plus) kit (Takara, China) on ABI7500 Real-time system (Applied Biosystems ...
-
Core Microbiota Drive the Prevalence of Extracellular Antibiotic Resistome in the Water CompartmentsbioRxiv - Microbiology 2022Quote: ... High throughput qPCR (HT-qPCR) was implemented on SmartChip PCR system including a Multisample Nanodispenser and a Cycler (Takara SmartChip™ ...
-
bioRxiv - Biochemistry 2022Quote: Expression inserts for cell lines were generated by PCR amplification and ligated into the pLVX-tight-Puro vector (Clontech) using the NEB HiFi DNA Assembly Kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2022Quote: ... Forty ng cDNA was used as templates for RT-PCR using SYBR® Premix Ex Taq kit (TaKaRa, #RR820A) using LightCycler 96 (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... the open reading frame was amplified from a larval brain cDNA library using CloneAmp HiFi PCR Premix (Takara Bio). For the HA-tagged version ...
-
bioRxiv - Cell Biology 2020Quote: Constructs used for HEK 293T IP studies were cloned into pcDNA3.1 vector using PCR-based In-Fusion HD cloning (Clontech). KIF5 (pBa-GFP-lnkr-mmKIF5A ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments including the mutations inserted were obtained by RT-PCR using PrimeSTAR GXL DNA polymerase (Takara, cat# R050A) and the following primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... with PCR using the primers listed in Table 1 and cloned into pmCherry-C1 (CMV promoter; Takara Bio Inc.). pEGFP-C3 K19 WT ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products of EgGLUT1-ss gene were recovered from Agarose Gel with Agarose Gel DNA Extraction Kit (Takara, Japan), and the amplified fragments were cloned into pMD19-T vector with Mighty ta-cloning Reagent Set for Prime STAR (Takara ...
-
bioRxiv - Microbiology 2021Quote: ... All cDNAs were amplified using polymerase chain reaction (PCR) and the Tks Gflex DNA Polymerase (Takara Bio., Shiga, Japan). The amplified cDNAs were cloned into the indicated plasmids using an In-Fusion HD cloning kit (Clontech ...
-
bioRxiv - Biophysics 2021Quote: ... using KOD One PCR Master Mix (TOYOBO) was subcloned into the AgeI- and NotI-digested EGFP-N1 vector (Clontech), and subsequently full-length EGFR fragment was subcloned into the NheI- and HindIII-digested the LgBiT-inserted EGFP-N1 vector ...
-
bioRxiv - Genomics 2022Quote: ... prior to another round of PCR amplification for 16-18 cycles using either LA-Taq or PrimeSTAR GXL (Takara) at an annealing temperature of 60℃.
-
bioRxiv - Evolutionary Biology 2022Quote: ... and then was transcribed to cDNA using the Clontech SMARTer PCR cDNA Synthesis Kit (Clontech, Mountain View, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Human PDE4D5 wild type and PDE4D5-dN mutant were PCR amplified and cloned into pLVX-mCherry-N1 vector (Clontech) using Gibson assembly after vector digestion with XhoI and EcoRI ...
-
bioRxiv - Cell Biology 2019Quote: ... Each sub-cloning was done by using the In-Fusion PCR cloning kit (Clontech Laboratories, Mountain View, CA, USA). Plasmids were integrated at the lys1 gene locus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Full length cDNA synthesis was done from polyA RNA using Clontech SMARTer PCR cDNA synthesis kit (Clontech Laboratories; (23)) ...
-
bioRxiv - Molecular Biology 2019Quote: Each polymerase chain reaction (PCR) was carried out in 50-µL volumes containing 2U Taq DNA polymerase (Takara Co.), approximately 20 ng template DNA ...
-
bioRxiv - Biochemistry 2019Quote: ... Both PCR-amplified sequences were cloned into a pLVX-Puro vector (Clonetech) using Gibson assembly (In-Fusion cloning, Takara), to form GCP2_G5A_TEV_G5A_mTagBFP_G5A_BAP ...
-
bioRxiv - Cell Biology 2020Quote: EGFP-Rab5 construct was generated by PCR amplifying human Rab5a from cDNA and subcloning into the pEGFP-C2 (Clontech) vector using XhoI/BamHI restriction sites ...
-
bioRxiv - Neuroscience 2020Quote: ... The mRNA expression was quantified using the SYBR green PCR kit (TaKaRa SYBRR Premix Ex Taq. II, Dalian, China) in a CFX96 Touch apparatus (Bio-Rad ...
-
bioRxiv - Developmental Biology 2019Quote: ... The rearranged region between the promoter and GOIs (500-600 bp) was amplified using CloneAmp HiFi PCR premix (Clontech) followed by Sanger sequencing (Genewiz ...
-
bioRxiv - Cancer Biology 2019Quote: ... Real-time quantification PCR was performed using the SYBR Premix Ex Taq II (Tli RNase H Plus) (Takara, Japan) with the following primers ...
-
bioRxiv - Plant Biology 2020Quote: ... the DNA fragment of the mutation site was amplified by PCR using Takara Ex Taq polymerase (Takara Bio, Japan) followed by the dye terminator cycle sequencing reaction with the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... The molar concentration of the library was determined by quantitative PCR (qPCR) using Library Quantification kit (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PCR products were cloned into the transcription vector pTB-207 [88] using the In-Fusion HD Cloning kit (Clontech) as described previously [89] ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PCR products were cloned into the transcription vector pTB-207 (69) using the In-Fusion HD Cloning kit (Clontech) as described previously (70) ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-SERT was digested with HindIII and AfeI and the PCR product was inserted by InFusion Cloning (Takara Clontech) to generate pAAV-SERT His-GCaMP6s ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplified using VR47F/R and cloned into KpnI and HindIII cut pOPINRSF using In-Fusion cloning (Takara Bio), resulting in pVR01 ...
-
bioRxiv - Microbiology 2019Quote: ... Purified PCR fragments were inserted into the pHEX2 plasmid (53) using the In-Fusion HD Cloning Plus kit (Clontech). Expression of the transgenes was controlled by the SAG1 promoter and selection was provided by the presence of the HPT selectable marker (50) ...
-
bioRxiv - Immunology 2020Quote: ... 1 μg of RNA per sample was used for first-strand synthesis by SMARTer PCR cDNA Synthesis Kit (Clontech). For quantitative RT-PCR (qPCR) ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Immunology 2020Quote: ... The RT products were amplified by nested PCR following the PrimeSTAR® HS DNA Polymerase kit protocol (Takara, Japan), with primers for TCRα and TCRβ ...