Labshake search
Citations for Takara Bio :
1901 - 1950 of 2391 citations for PCR Tube since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... respectively) and an mCherry coding sequence were amplified from the template plasmid by PCR using PrimeSTAR GLX DNA polymerase (TAKARA) along with the sense and antisense primer pair (5’-ATTACCTGGGGGTATCCCCTT-3’ and 5’-CACTCTTCTGGTTGTGGTTGC-3’) ...
-
bioRxiv - Pathology 2021Quote: ... 5 µL of 1:10 diluted cDNA samples was used as the qRT-PCR template with 0.5 µM gene-specific primers and 10 µL SYBR Premix Ex Taq II (Takara, China) in a total volume of 20 µL ...
-
bioRxiv - Biophysics 2020Quote: ... Mutations with multiple amino acids were introduced by ligating inverse PCR-amplified backbone with mutations bearing DNA oligonucleotides via the In-Fusion Cloning Kit (ClonTech). All mutants were confirmed by Sanger sequencing.
-
bioRxiv - Cell Biology 2021Quote: ... One microgramme of total RNA was reverse-transcribed using a One Step PrimeScript™ RT-PCR Kit (Takara, Liaoning, China) with a thermocycler ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... ORFV120 and ORFV113 coding sequences were PCR-amplified from orf virus strain OV-IA82 genome and cloned into p3xFlag-CMV-10 vector (pFlag) (Clontech).
-
bioRxiv - Microbiology 2020Quote: ... The EGFP-nsP3 truncations and alanine substitution mutations were constructed by subcloning the corresponding nsP3-encoding PCR products into the vector pEGFP-C1 (Clontech) using XhoI-KpnI restriction sites.
-
bioRxiv - Microbiology 2020Quote: ... Cells were originally obtained from ATCC (except MAGIC5 cells) and routinely tested negative for mycoplasma contamination (PCR Mycoplasma Detection kit, Takara).
-
bioRxiv - Microbiology 2020Quote: ... The infectious titer of lentivirus was determined by a Lenti-X™ qRT-PCR Titration Kit (Clontech, Mountain View, CA).
-
bioRxiv - Molecular Biology 2021Quote: ... Mutations with multiple amino acids were introduced by ligating inverse PCR-amplified backbone with mutations bearing DNA oligonucleotides via the In-Fusion Cloning Kit (ClonTech). All mutants were confirmed by Sanger sequencing.
-
bioRxiv - Immunology 2021Quote: Variable heavy chain and light chain sequences were PCR amplified from yeast plasmid DNA and cloned into CMV/R IgG expression vectors using InFusion (Takara). Plasmid DNA for mammalian expression of the His-tagged SARS-CoV-2 RBD in a pCAGGS vector was kindly provided by Dr ...
-
bioRxiv - Microbiology 2021Quote: ... three inserts were amplified by PCR and sequentially inserted in two steps using the In-Fusion HD Cloning Kit (Clontech). In the first step ...
-
bioRxiv - Immunology 2020Quote: ... This construct was cloned out of the parent vector and into an in-house pADD2 vector using HiFi PCR (Takara) followed by In-Fusion (Takara ...
-
bioRxiv - Microbiology 2021Quote: Expression plasmids encoding for human ZMPSTE24 with and without a C-terminal FLAG-tag or HA-tag were PCR amplified and subcloned into the pQXCIP (Clontech) backbone using flanking restriction sites AgeI and BamHI ...
-
bioRxiv - Genetics 2019Quote: ... the genes of interest were PCR amplified adding SfiI restriction sites and ligated to modified version of the vectors pGBKT7 and pGADT7 (Clontech) containing SfiI restriction sites.
-
bioRxiv - Cell Biology 2021Quote: ... mCherry-STIM1-10A and WT STIM1 were constructed by inserting PCR fragments into XhoI-HpaI sites of pMSCV-puro vector (Clontech) and were packaged using the Phoenix-ECO cell line (ATCC CRL-3214) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The concentrations of the host and the parasitic RNAs were measured by RT-qPCR (PrimeScript One Step RT-PCR Kit (TaKaRa)) with sequence-specific primers (Supplementary text).
-
bioRxiv - Genetics 2020Quote: ... The products obtained were subsequently subjected to semi-nested PCR with a LA Taq Hot Start polymerase kit (TaKaRa Biotechnology). The first round of amplification was performed with primers ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using TOYOBO THUNDERBIRD SYBR qPCR Mix on a Thermal Cycler Dice Real Time System (Takara Bio). The average threshold cycle value (CT ...
-
bioRxiv - Microbiology 2020Quote: ... which corresponds to the S23Q/L24M mutant of SARS-CoV-2 Wuhan-Hu-1 ORF3b *57) was generated by overlap extension PCR by using PrimeSTAR GXL DNA polymerase (Takara), the SARS-CoV-2 ORF3b 155* as the template ...
-
bioRxiv - Microbiology 2022Quote: ... 10 ng of linearized pDEST32 empty vector was co-transformed with 3 μl of PCR product to achieve recombinational cloning by gap-repair in Y2H Gold yeast strain (Clontech) expressing AD-fused CP204L (pPC86 vector) ...
-
bioRxiv - Developmental Biology 2022Quote: ... first-strand cDNA synthesis and subsequent cDNA amplification by 22 cycles of polymerase chain reaction (PCR) were performed using the SMARTer stranded RNA-seq kit (Takara). The synthesized first-strand cDNA and amplified cDNA were purified using Ampure XP Beads (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2022Quote: ... pCAGGS was digested by SpeI and BamHI and assembled with the PCR products by an In-Fusion HD cloning system (Clontech). After transformation into DH5α ...
-
bioRxiv - Biochemistry 2022Quote: A DNA fragment coding C-terminally His-tagged Gtsf1 or Gtsf1L was amplified by PCR and cloned into pCold vector (Takara) by In-fusion cloning kit (Takara) ...
-
bioRxiv - Biochemistry 2022Quote: A DNA fragment coding HA-tagged Dcp2 was amplified by PCR and cloned into pIExZ vector (Izumi et al, 2020) by In-fusion cloning kit (Takara).
-
bioRxiv - Biochemistry 2022Quote: cDNA fragment of Gtsf1 was amplified by RT-PCR from BmN4 total RNAs and cloned into pIExZ vector (Izumi et al, 2020) by In-fusion cloning kit (Takara).
-
bioRxiv - Biochemistry 2022Quote: A cDNA fragment of Gtsf1L was amplified by RT-PCR from BmN4 total RNAs and cloned into pIZ vector by In-fusion cloning kit (Takara).
-
bioRxiv - Evolutionary Biology 2022Quote: ... The cDNA samples were cloned into a pUC19 vector (PCR-amplified with primers 11 and 12) using In-Fusion HD Cloning Kit (Takara). After transformation into Escherichia coli ...
-
bioRxiv - Genomics 2022Quote: Genomic DNA was used as a template for quantitative PCR analysis on a Thermal Cycler Dice Real Time System (TaKaRa) using KAPA SYBR Fast qPCR Kit (KAPA Biosystems ...
-
bioRxiv - Genetics 2022Quote: ... RE79 and RE97) was PCR-amplified from BAC (RP23-11P22, RP23-423B1) or genomic DNA with overhangs for InFusion cloning (Takara). The fragments were ligated into a BamHI digested FIREWACh plasmid FpG5 (Addgene #69443 ...
-
bioRxiv - Developmental Biology 2022Quote: Candidate enhancer sequences identified from the integrated analysis from scRNA-seq and scATAC-seq were PCR amplified (TAKARA, PrimeSTAR GXL) from mouse genomic DNA and PCR products cloned into pGL4.23 (Promega ...
-
bioRxiv - Plant Biology 2022Quote: ... The genomic DNA sequences surrounding the potential off-target sites were amplified by PCR using specific primers (Supplemental Table S1) and PrimeSTAR GXL DNA Polymerase (Takara). PCR products were analyzed by sequencing.
-
bioRxiv - Plant Biology 2022Quote: ... the PCR products amplified by the primers spanning the introns were purified and cloned into pMD19-T vector (TaKaRa, D102A). About 10~20 clones of each PCR products were sequenced and aligned with the corresponding genes by SnapGene software.
-
bioRxiv - Plant Biology 2022Quote: ... NLS and FLAG tag coding sequence were amplified from HBT_pcoCASphi_version1 and version2 plasmids and cloned into the digested vector together with PCR amplified pUB10 and Rbcs E9 terminator by TAKARA in-fusion HD cloning kit (cat639650) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The ORF of zebrafish znf598 (ENSDARG00000014945) was amplified by RT-PCR and cloned into pCS2+ via XhoI/XbaI restriction sites using DNA Ligation Kit (TAKARA). To generate znf598 point mutation in ORF (znf598 C13/16A) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The ORF of zebrafish rpl36 (ENSDARG00000100588) was amplified by RT-PCR and cloned into pCS2+ via EcoRI/XhoI restriction sites using DNA Ligation Kit (TAKARA). The ORF of zebrafish znf598 (ENSDARG00000014945 ...
-
bioRxiv - Plant Biology 2023Quote: ... The bisulfite-converted library was split between two 50 ul reactions and PCR amplified using the following conditions: 2.5 U of ExTaq DNA polymerase (Takara Bio), 5 μl of 10X Extaq reaction buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Fragments encoding the CD45 extracellular domain (ECD) and transmembrane region were amplified by PCR and cloned into pEGFP-N1 (Clontech) using the EcoRI and BamHI restriction sites ...
-
bioRxiv - Microbiology 2023Quote: ... inverse PCR amplification was conducted with oligonucleotides and templates listed in Table S1 and the resulting PCR products were treated with T4 Polynucleotide Kinase (Takara) and ligated with a DNA ligation kit (Takara) ...
-
bioRxiv - Plant Biology 2023Quote: ... Synthesized cDNA was amplified by real-time quantitative PCR (qPCR) with TB Green Premix Ex Taq (Tli RNaseH Plus) (Takara) using the QuantStudio 3 system (Applied Biosystems) ...
-
bioRxiv - Zoology 2023Quote: ... primers were designed on each scaffold using Primer3Plus (https://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) (Table S3) and PCR was performed using PrimeSTAR Max DNA Polymerase (Takara Bio, Shiga, Japan). The sequences of the PCR products ...
-
bioRxiv - Neuroscience 2022Quote: ... the BamHI/BsrGI digested PCR product was ligated to the linearized backbone using the DNA Ligation Kit - Mighty Mix (TaKaRa) resulting pPB-ef1a-NLS-EGFP-T2A-puro.
-
bioRxiv - Neuroscience 2022Quote: ... the PCR fragments containing InDels were cloned into pL253 at the NotI and SpeI sites via InFusion cloning (Takara #ST0344). Bacterial recombinants were screened via PCR using primers 253.S (caaggcgattaagttgggtaac ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNAs (1-5 ng RNA equivalents) were used for real-time PCR amplification using SYBR Premix Ex Taq II (Takara/Clontech) on a 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Probes for FLuc (500 bp) were generated using gel-purified PCR amplicons containing GFP sequence and a BcaBEST Labeling kit (Takara) and [α-32P]-dCTP (PerkinElmer) ...
-
bioRxiv - Bioengineering 2022Quote: ... The solution was heated at 65°C for 5 minutes using Takara® PCR Thermal Cycler (Takara Corp., Shiga, Japan), and then gradually cooled down to 30°C over a time span of 10 minutes before settling down to 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... RNAi-resistant full length LIC1 and LIC2 and LIC1 truncations were generated by PCR and restriction digest cloning into pEGFP-C3 (Clontech) and used for rescue experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length and truncated Cntn1 was PCR amplified from rat contactin-myc 34 and ligated together using an In-Fusion Snap Assembly Master Mix (Takara). All DNA constructs were verified by sequencing (Genewiz and plasmidsaurus).
-
bioRxiv - Cell Biology 2023Quote: candidate factors were prepared by subcloning the ORF template clones by PCR amplification with Prime STAR GXL DNA polymerase (Takara) and ligation by In-Fusion cloning enzyme (Clontech).
-
bioRxiv - Cell Biology 2022Quote: ... Wild-type iRhom2 and iRhom2-1-374 were also cloned by PCR into pM6P.Blasticidin (for retroviral infection) and into pLVX-TetOne-Puro vector (Clontech, #631849) (for lentiviral infection) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Wildtype and mutant constructs were then PCR amplified using primers to encompass HA-EZH2 + add NotI and PacI for subcloning into pQXCIH (Clontech). See Supplemental Table 1 for the primer sequences ...