Labshake search
Citations for Takara Bio :
1751 - 1800 of 2391 citations for PCR Tube since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... The first-strand cDNA for qRT-PCR was synthesized from 100 ng total RNA using PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa). For qRT-PCR ...
-
bioRxiv - Biochemistry 2021Quote: ... A total of 5 μg of RNA were reverse transcribed and amplified using One Step SYBR Prime-Script PLUS RT-PCR Kit (TaKaRa) and the Thermal Cycler Dice instrument (TaKaRa ...
-
bioRxiv - Microbiology 2020Quote: ... CTCF BS1 and CTCF BS2 were mutated by site-directed PCR mutagenesis using the primers detailed in Table 1 and Prime Star Max (Takara) mutagenesis kit following the manufacturer’s protocols and confirmed by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-GFP plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and GFP from pEGFP-N1 (BD Biosciences Clontech) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... to a final concentration of 108-109 IFU/ml using the Lenti-x qRT-PCR Titration Kit (Takara, cat.631235). Lentivirus with MOI of 10 was used for transduction of MOVAS cells ...
-
bioRxiv - Cell Biology 2020Quote: ... Real-time PCR was performed on 15 ng of cDNA using SYBR Premix Ex Taq (Tli RNaseH Plus) (Takara RR420W) in a reaction volume of 20 μl ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Cell Biology 2020Quote: ... at the C-terminus were amplified by PCR using KOD-Plus-Neo polymerase (Toyobo) and Human Universal QUICK-Clone cDNA II (Clontech) for a template cDNA and then cloned into a pET-41 Ek/LIC vector (Novagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... TTAGCTAGCCTTCTGATGTGATAGTTTATC TTCTG-3’ were used to amplify the 3xFLAG-BBS10 from the BBS10 ORF plasmid using CloneAmp HiFi PCR premix (Takara), which was further cloned into the CD520A-GFP plasmid via XbaI and Nhe I restriction sites ...
-
bioRxiv - Developmental Biology 2021Quote: ... Real-time quantitative PCR was performed in triplicate using the SYBR Premix Ex Taq (Tli RNase H Plus) kit (Takara). The expression of TBP was used for the normalization of mRNA expression ...
-
bioRxiv - Genetics 2021Quote: ... and then RT-qPCR was performed using a One Step SYBR PrimeScript PLUS RT-PCR kit (Takara Bio, Shiga, Japan) and Applied Biosystems ABI Prism 7000 Sequence Detection System ...
-
bioRxiv - Microbiology 2020Quote: ... DNA sequences that flanked the ittA sRNA locus were amplified using PCR with PrimeSTAR GXL polymerase (Takara, Mountain View, CA). For the upstream fragment ...
-
bioRxiv - Developmental Biology 2021Quote: The cDNAs for HA-tagged ELF3 were amplified from the KhES-1 cDNA library by PCR using PrimeSTAR GXL (Takara) and were subcloned into the pENTR/D entry vector (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... and first-strand cDNA was synthesized with 1 μg of total RNA using a SuperScript III First-Strand Synthesis System for RT-PCR (TaKaRa) following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: msPLCε cDNA was amplified by PCR from a mouse liver first-strand cDNA library (kindly gifted from Tomohiro Ishii) using Tks Gflex polymerase (TaKaRa) and was cloned between the NheI and KpnI sites of pECFP-N1 (Clontech ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mtDNA copy number was determined by quantitative PCR with Human mitochondrial to nuclear DNA ratio kit (Takara Bio USA, 7246).
-
bioRxiv - Immunology 2022Quote: ... The following plasmids were generated by insertion of PCR-amplified fragments into the NotI-to-PmeI digested pEF-TAK-Flag using InFusion cloning (Clontech): pEF-TAK-Flag-UFL1 (GenBank ...
-
bioRxiv - Plant Biology 2022Quote: ... 1500 bp upstream sequence from +1 site of both AtNRAMP4 and AtPIC1 genes were amplified by PCR and subsequently cloned into the KpnI and SacI RE sites of the pAbAi vector (Takara). On the other hand ...
-
bioRxiv - Molecular Biology 2021Quote: ... UAS-dH1::GFP and UAS-dH1K27A::GFP stocks were prepared by inserting the corresponding ORFs (WT or carrying a K27A mutation generated by PCR) into pEGFP (Clontech) to generate fusion proteins and then the inserts were cloned into pUAST (details can be provided on request) ...
-
bioRxiv - Molecular Biology 2021Quote: Nested translocation PCR assays was performed from genomic DNA as previously described (29) using either LA Taq DNA polymerase (Takara) or Flex HS polymerase (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... LC NLS deletion (Δ417-422) was generated by KOD One PCR amplification and the In-Fusion HD Cloning Kit (Clontech). The NLS of SUN2 (KDSPLRTLKRKSSNMKRL ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Molecular Biology 2021Quote: ... The first stranded cDNA was next amplified to produce double stranded cDNA in 20 amplification cycles by long distance PCR using the Advantage 2 polymerase mix (Takara, Clontech) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by reverse transcription of the enriched mRNA into cDNA using Clontech SMARTer PCR cDNA Synthesis Kit (Takara, Shiga, Japan). PCR cycle optimization was used to determine the optimal amplification cycle number for the downstream large-scale PCR reactions ...
-
bioRxiv - Cancer Biology 2019Quote: ... we performed 30 separate 100 μL PCR reactions with 10 μg genomic DNA in each reaction using ExTaq DNA Polymerase (Clontech) then combined the resultant amplicons ...
-
bioRxiv - Cell Biology 2019Quote: The GFP-TAZ and GFP-YAP constructs were generated by PCR and sub-cloned into the pEGFP-C1 vector (Clontech) or pGFP-2xStrep vector ...
-
bioRxiv - Plant Biology 2019Quote: ... The qRT-PCR was performed by the instruction of SYBR Premix Ex Taq (Tli RNaseH Plus; Takara Biotechnology, Dalian, China). The reaction condition was ...
-
bioRxiv - Developmental Biology 2019Quote: ... The expression of each gene was determined by q-PCR using the SYBR Premix Ex Taq (RR402A; Takara Bio. Inc.), and β-actin was used as the reference gene ...
-
bioRxiv - Biochemistry 2019Quote: ... 5’UTRs of MAGED2 TV2 and TV3 were amplified by RT-PCR from RNA isolated from human testes tissue purchased from Takara Bio (Mountain View ...
-
bioRxiv - Microbiology 2019Quote: ... These PCR products were cloned into pCA24N with a C-terminal GFP tag using the In-Fusion HD enzyme kit (Takara). Clones were selected on TSA plates with 50µg/ml chloramphenicol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR products were cloned into pBAD28 vector (ATCC® 87400™) by using In-Fusion HD Cloning kit (Takara) by using primers 7 and 8 to amplify pBAD28 vector (Table S2 ...
-
bioRxiv - Plant Biology 2019Quote: ... The qRT-PCR amplification was run in an ABI 7500 HT (Life technology) with SYBR Green I Master Mix (TaKaRa), and the reaction mixture and program was carried out as described in our previous work (Wu et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... Antisense probes for ccna1/ ccna2/ ccne1/ top2a were made using the PCR products as templates for RNA synthesis with T7 RNA polymerases (Takara). The stained embryos were dehydrated in glycerol and photographed with a Nikon SMZ1500 stereomicroscope (Nikon ...
-
bioRxiv - Cancer Biology 2019Quote: ... The resultant cDNA was subjected to real-time PCR by using SYBR® Premix Ex Taq™ II (Takara Bio) and specific primer sets (Takara Bio) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... the iLID-encoding sequence was PCR-amplified from Venus-iLID-CAAX and inserted into CRY2PHR-mCh-iTrkA7 at XhoI and SmaI using In-Fusion (Clontech). iLID-mRuby3-iTrkB was generated by PCR amplification of iLiD ...
-
bioRxiv - Microbiology 2019Quote: ... pcDNA-TCRα was digested with EcoRI and incubated with purified PCR product amplified with the PrimeStar DNA polymerase (Takara – Ozyme) for 3 min at RT followed by 10 min on ice ...
-
bioRxiv - Microbiology 2019Quote: ... A plasmid encoding a gene fusion between the 5‘-201 nucleotides of PR8 segment 5 and GFP was made by PCR-cloning the appropriate IAV sequence into pEGFP-1 (Clontech), followed by oligonucleotide-directed PCR mutagenesis (using standard protocols ...
-
bioRxiv - Pathology 2021Quote: ... Viral titering was performed using 15 μL of unconcentrated virus or 1.5 μl of concentrated virus with the Lenti-X qRT-PCR Titration Kit (Clontech, 632165). Results were read on an ABI QuantStudio 6 RT-PCR machine.
-
bioRxiv - Genetics 2020Quote: ... Human CAD was PCR amplified from cDNA (Open Biosystems clone ID 5551082) using specific primers (Table S1) and ligated with In-Fusion (Clontech) into NotI linearized pcDNA3.1-GFP ...
-
bioRxiv - Genomics 2021Quote: ... Target regions were amplified by PCR using specific primer sets and high-fidelity PrimeSTAR GXL DNA polymerase (Takara, Shiga, Japan). Sanger sequencing was performed using BigDye Terminator reactions and loaded onto a 3730xl DNA analyzer (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Genes of target prokaryotic proteins were amplified by PCR from corresponding genomic DNA and inserted into the pEGFP-C1 vector (Clontech). Mutated genes of prokaryotic proteins were obtained by PCR site-specific mutagenesis ...
-
The Ets protein Pointed P1 represses Asense expression in type II neuroblasts by activating TaillessbioRxiv - Developmental Biology 2021Quote: ... Tll or PntP1 coding region was amplified using the CloneAmp HiFi PCR Premix (Catalog# 639298, Takara Bio., Mountain View, CA) from a cDNA library and cloned into pcDNA™3.1/His expression vectors (Catalog #V38520 ...
-
bioRxiv - Developmental Biology 2021Quote: All novel plasmids constructed for this study were based on the pSP Sox1/2/3> plasmid previously described (9) with the open reading frames replaced by PCR amplifications using a proofreading DNA polymerase (Primestar, Takara) and plasmids were assembled from linear PCR products using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative PCR was performed with the ABI PRISM Fast 7500 Real-Time PCR engine using the TB Green Premix Ex TaqII (TIi RNaseH Plus) (TaKaRa) and the miRcute Plus miRNA qPCR kit (SYBR Green ...
-
bioRxiv - Cell Biology 2021Quote: ... The vimentin-null mEFs expressing vimentin are created by PCR amplification of the vimentin coding sequence using CloneAmp polymerase (Clontech) from pcDNA4-vimentin (provided by J ...
-
bioRxiv - Bioengineering 2020Quote: ... 500 ng of total RNA was reverse transcribed (complementary DNA (cDNA) was synthesized using PrimeScript™ RT-PCR Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Lentivirus was concentrated from supernatant using ultracentrifugation and the genome copy number was calculated using the Clontech Lenti-X qRT-PCR Titration kit (Takara).
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product was cloned into pET28a digested with restriction enzymes NotI and NdeI using InFusion HD Cloning (Takara Bio). Both cloning strategies introduce a hexahistidine tag followed by a thrombin cleavage sequence ...
-
bioRxiv - Biophysics 2021Quote: ... denatured at 85°C for 5 minutes and annealed at 47.5°C for 4 hours in a PCR machine (Takara-Bio). The folded DNA origami was then agarose-gel-purified (Douglas et al ...