Labshake search
Citations for Takara Bio :
51 - 100 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... For beta-catenin overexpression the CHIR99021 was substituted with 1 µg/ml doxycycline (Clontech).
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA libraries were then synthesized using the SMARTer PCR cDNA Synthesis Kit (Clontech; PT4097-1) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... rabbit anti-DsRED (1:1000; Clontech, Cat # 632496), chicken anti-GFP (1:250 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Reporter plasmid libraries were made by cloning amplified ATAC fragments into AgeI-HF- and SalI-HF-linearized pSTARR-seq plasmid using InFusion HD cloning kit (Takara) and then propagated in MegaX DH10B T1R electrocompetent bacteria ...
-
bioRxiv - Developmental Biology 2024Quote: ... low-passage 3.5×106 Hek293T Lenti-X cells (632180, Takara) were seeded per 10 cm dish (Corning ...
-
bioRxiv - Developmental Biology 2024Quote: ... Hek293T Lenti-X cells (632180, Takara) were used for making lentivirus ...
-
bioRxiv - Developmental Biology 2024Quote: ... qPCR was performed with the SYBR Premix Ex Taq kit (TaKaRa) with Rplp0 serving as the internal control ...
-
bioRxiv - Developmental Biology 2024Quote: ... Primary antibodies used were CDH1 (E-CADHERIN) (M106, Takara Biosciences) for glandular and luminal epithelial staining ...
-
bioRxiv - Developmental Biology 2024Quote: ... Foamy virus was produced using Lenti-X 293T (Takara Bio, Kusatsu) generated as previously described and frozen at -80°C for long term storage42 ...
-
bioRxiv - Developmental Biology 2024Quote: ... samples were heat-shock transformed into stellar competent cells (Takara Bio, Kusatsu). SOC outgrowth was performed for 1 hour at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were generated and sequencing was performed by the NY Genome Technology Center with a low input SMART-Seq HT with Nxt HT kit (Clontech Laboratories, 634947) and SP100 cycle flow cell ...
-
bioRxiv - Developmental Biology 2024Quote: ... anti-Ds-Red (rabbit, 632496; Clontech; 1:500), anti-mCherry (chicken ...
-
bioRxiv - Developmental Biology 2024Quote: Using the Cogent NGS Analysis Pipeline software v 1.5.1 (Takara), FASTQ files containing all indices for each chip were demultiplexed to FASTQ files containing one index per file ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 20 minutes on ice and then dispensed into the nano-well plates of the ICELL8® cx Single-Cell System (Takara). Wells containing single viable cells were automatically selected using the ICELL8 cx CellSelect v2.5 Software (Takara ...
-
bioRxiv - Developmental Biology 2024Quote: ... The library for sequencing was then prepared using the SMART-Seq ICELL8 application kit (Takara) following the manufacturer’s recommended protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... the SMART-seq v4 Ultra Low Input RNA kit (Takara) was used to prepare cDNAs starting from 1.5 µg of total RNA for each sample and sequencing libraries were prepared subsequently prepared using the Ovation Ultralow System V2 (NuGen) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Wells containing single viable cells were automatically selected using the ICELL8 cx CellSelect v2.5 Software (Takara) with the green and not red logic ...
-
bioRxiv - Developmental Biology 2024Quote: ... linker italics) were used to PCR amplify (Takara PrimeStar Max) the homology repair template (HRT) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Library construction started from 4.9ng of RNA per sample made using the SMARTer Stranded Total RNA-seq Kit v3-Pico Input Mammalian (Takara; 634486). The quality of libraries was checked with the with the High Sensitivity DNA Reagents Kit (Agilent ...
-
bioRxiv - Genomics 2024Quote: ... Library construction was performed based on the manufacturer’s recommendation for SmarterStranded V2 kit (Takara Bio, California, USA). The final library quantity was measured by KAPA SYBR FAST qPCR and library quality was evaluated by TapeStation D1000 ScreenTape (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: ... wherein 2.5 µg of pooled plasmid was diluted with Xfect reaction buffer (Takara Bio, 631318) to a total volume of 50 μL ...
-
bioRxiv - Immunology 2024Quote: ... cDNA libraries were prepared using SMARTer Stranded Total RNA-Seq Kit v3 - Pico Input Mammalian (Takara, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Quantified PCR was performed using SYBR Premix Ex Taq Kit (Takara Bio Inc., Japan), and carried out on ABI Prism 7000 sequence detection system (Applied Biosystems USA) ...
-
bioRxiv - Microbiology 2024Quote: ... Total RNA was extracted using the RNAiso Plus kit (Takara, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: RNA extract used for sequencing above was treated with RNase-Free DNase (Takara) to remove contaminated DNA ...
-
bioRxiv - Microbiology 2024Quote: ... and cDNA was synthesized using the M-MLV Reverse Transcriptase cDNA Synthesis Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... membrane and concentrated up to 10-fold using Lenti-X Concentrator (TaKaRa). The virus pellet was resuspended in 100 µL of Phosphate Buffered Saline (PBS ...
-
bioRxiv - Microbiology 2024Quote: ... The reverse transcription was performed using the PrimeScript RT reagent kit (Takara, Saint-Germain-en-Laye, France) with a primer oligo-d(T)-AP (5’ GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTv 3’) ...
-
bioRxiv - Microbiology 2024Quote: ... PCR DNA amplifications were performed with CloneAmp HiFi PCR premix (Takara) using Primer-AP (5’ GACCACGCGTATCGATGTCGAC 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... linearized GPC sequence was gel purified using NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: The WOo DNA methyltransferase was artificially synthesised with codon usage adaptation and cloned into the XhoI and SalI sites of the pCOLD III expression vector (Takara Bio). The recombinant construct was transformed into Escherichia coli StellarTM Competent Cells (dam–/dcm– ...
-
bioRxiv - Genetics 2024Quote: ... The lentivirus was concentrated using the Lenti-X concentrator (Takara Bio). The viral titer was determined by performing lentiviral transductions at varying concentrations in a 48-well plate format ...
-
bioRxiv - Genetics 2024Quote: Lentivirus was produced in the Lenti-X 23T cell line (Takara Bio). Transfection was carried out with psPAX2 (Addgene #12260) ...
-
bioRxiv - Genomics 2024Quote: Approximately 4×106 HAP1 cells were transfected using Xfect Transfection Reagent (#631318, Takara Bio) for each pSpCas9(BB)-2A-Puro construct ...
-
bioRxiv - Genomics 2024Quote: ... The polymerase chain reaction (PCR) was performed on genomic DNA to amplify 16s rRNA using Emerald Amp MAX PCR Master Mix (Takara Bio) using the primers presented in Table S1.
-
bioRxiv - Genomics 2024Quote: ... and one microgram of the DNase-treated RNA was used for cDNA synthesis using PrimeScript RT reagent kit (Takara Bio, CA, USA). The expression analysis was performed using TB green Premix Ex Taq II (Takara Bio ...
-
bioRxiv - Genomics 2024Quote: ... The expression analysis was performed using TB green Premix Ex Taq II (Takara Bio, CA, USA) on Bio-Rad CFX 96 C1000 with following conditions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... the PCR master mix was prepared using Z-Taq (Takara R006B) and primers (Table S1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we then added 1 mL of Super Optimal Broth with Catabolite Repression Medium (SOC, provided with the electrocompetent cells (Takara, Japan, product #9027), shaking the cells at 230 RPM at 37°C for 1.5 hours (Infors HT ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... coli DH5α electrocompetent cells (Takara, Japan, product #9027) by adding 2 uL of (unpurified ...
-
bioRxiv - Genomics 2024Quote: ... with three markers (λ-Hind III digest; Takara Cat ...
-
bioRxiv - Genomics 2024Quote: ... with three markers (λ-Hind III digest; Takara Cat. No. 3403, DL15,000 DNA Marker; Takara Cat ...
-
bioRxiv - Genetics 2024Quote: Two μg of total RNA was reverse transcribed into cDNA templates using RNA to cDNA EcoDry™ Premix kit including both random hexamer and oligo(dT)18 primers (Takara Bio, 639548). KAPA SYBR® FAST qPCR Master Mix (2X ...
-
bioRxiv - Genetics 2024Quote: ... and NucleoSpin® RNA set for NucleoZOL™ (Takara Bio, 740406.50) following the manufactures specifications ...
-
bioRxiv - Genetics 2024Quote: ... and NucleoSpin® RNA Clean-up XS (Takara Bio, 740903) for RNA repurification ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The amplified PCR fragments were recombined into the yeast bait two-hybrid vector pGBKT7 (Takara Bio, Kusatsu, Japan), previously digested with EcoRI and BamHI ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and pGADT7-murine p53 (Takara Bio) were used as negative controls ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... thaliana Col-0 cDNA library (Takara Bio) transformed into the Saccharomyces cerevisiae Y187 strain (prey strain ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... transformed into the Saccharomyces cerevisiae Y187 strain (prey strain) was screened using the Matchmaker® Gold Yeast Two-Hybrid System (Takara Bio). For that purpose ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... according to manufacturer’s recommendations and using primers specifically designed for the In-Fusion cloning system (Takara Bio, Mountain View CA, USA). The amplified PCR fragments were recombined into the yeast bait two-hybrid vector pGBKT7 (Takara Bio ...