Labshake search
Citations for Takara Bio :
51 - 100 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... reverse transcription was performed using the PrimeScript RT reagent kit (TaKaRa, Kyoto, Japan). Real-time qPCR was carried out on a CFX Duet real-time PCR system (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... that were exposed immediately after infection and for about 44 to 48 h to 1 μg/mL Anhydrotetracycline (631310, TaKaRa, ATc) whereas control cultures were exposed to vehicle only (100% ethanol).
-
bioRxiv - Microbiology 2024Quote: ... and genomic DNA was removed using DNase I (TAKARA, Dalian, China). Next ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed in SYBR Premix Ex Taq II (Takara, Japan) solution using MltE RT-PCR primers (See Table S2 ...
-
bioRxiv - Microbiology 2024Quote: ... All RNA in the extract samples were converted into cDNA using the cDNA EcoDry Premix (Clontech, USA). Quantitative real-time PCR was performed using a CFX96 Real-Time System (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... packaging plasmid using the CalPhos Mammalian Transfection Kit (Takara). The next day ...
-
bioRxiv - Microbiology 2024Quote: ... Total RNA was extracted using RNApure FFPE Kit (CWBIO, Jiangsu, China) and then treated with DNase I (TaKaRa, Kyoto, Japan) to remove DNA contaminants ...
-
bioRxiv - Microbiology 2024Quote: ... The supernatants from the samples were added to 0.5 ml of a Talon metal affinity resin (Clontech, USA) equilibrated with binding buffer ...
-
bioRxiv - Microbiology 2024Quote: ... was constructed using infusion cloning (Clontech, USA), as previously reported (35) ...
-
bioRxiv - Microbiology 2024Quote: ... using Talon resin (BD ClonTech). Purified proteins were concentrated using 10 kDa cutoff Amicon Ultra Centrifugal Filters (Merck Millipore ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5U µl-1 RNase Inhibitor (Takara Bio, #2313B), 2.0µM Template Switching Oligo (TSO ...
-
bioRxiv - Cancer Biology 2024Quote: ... reverse-transcribed using a PrimeScript RT reagent Kit (Takara Bio Inc., Otsu, Japan), and amplified using ExTaqII SYBR Premix (Takara Bio Inc. ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR (CloneAmp HiFi PCR Premix, Takara-Bio Europe) genotyping was done with primers designed for each knock-out line that allowed for confirming either the presence of the wild-type (F-gt5/R-gt5WT and F-gt3WT/R-gt3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... with the SYBR® Premix Ex Taq (Tli RNaseH Plus, Takara), under conditions recommended by the manufacturer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The expressed protein was then purified using TALON Metal Affinity Resin (Takara Cat. # 635502) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 μM rapamycin analog AP21967 (AP, Takara 635056) was added ∼ 18 hr post-transfection to treat the cells for 6 – 10 hr to induce coaggregation.
-
bioRxiv - Molecular Biology 2024Quote: ... mouse monoclonal anti-GFP (JL8, Clontech, 632381, 1:1000) mouse monoclonal anti-vinculin (SantaCruz ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reverse transcription was performed by adding Primescript II master mix (Takara) to 1x concentration and incubating for 15min at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... An instrument called a cDNA synthesis kit was used to synthesize cDNA (Takara, Dalian, China). Subsequently ...
-
bioRxiv - Molecular Biology 2024Quote: ... and further processed with SMARTer Stranded RNA-Seq Kit (Takara; 634,839) and illumina Truseq Stranded mRNA Library Prep kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... cerevisiae strain JOS003 using the Quick and Easy Transformation Mix (Clontech). JOS003 is a strain in which the one endogenous EIF4E gene has been replaced by homologous recombination with a KanMX4 cassette ...
-
bioRxiv - Microbiology 2024Quote: ... and R624W was introduced to pTVT7_YG1_M using In-Fusion HD cloning kit (Takara Bio), primers containing mutation for insert sequence (5′-AACTTGGAAGTGCTTTGTGGTAGG-3′ ...
-
bioRxiv - Microbiology 2024Quote: ... Cloning was conducted using an In-Fusion HD cloning kit (Takara Bio, CA, USA), and the resulting plasmids were named pTVT7_YG1_S ...
-
bioRxiv - Neuroscience 2024Quote: ... The PCR product was then cloned into pLVX-EF1α-IRES-Puro (Clontech, Takara Bio, 631988) using EcoRI and NotI restriction sites to generate pLVX-EF1α-mitoSRAI-IRES-Puro ...
-
bioRxiv - Neuroscience 2024Quote: ... The PCR product was then cloned into pLVX-EF1α-IRES-Puro (Clontech, Takara Bio, 631988) using EcoRI and NotI restriction sites to generate pLVX-EF1α-mitoSRAI-IRES-Puro ...
-
bioRxiv - Physiology 2024Quote: The pGG2-TNNT2-HA-TTL and the pAAV-TNNT2-Empty plasmids were generated from the pGG2-TNNT2-Mut1 plasmid (VC206) by InFusion Cloning (Takara Clontech). In brief ...
-
bioRxiv - Physiology 2024Quote: The pGG2-TNNT2-HA-TTL and the pAAV-TNNT2-Empty plasmids were generated from the pGG2-TNNT2-Mut1 plasmid (VC206) by InFusion Cloning (Takara Clontech). In brief ...
-
bioRxiv - Physiology 2024Quote: ... Virus containing medium was collected at 48h and concentrated using Lenti-XTM Concentrator (Takara). C2C12 mouse myoblasts were seeded 24h prior to infection and then transduced with virus-containing supernatant supplemented with 8μg/mL polybrene (Millipore ...
-
bioRxiv - Plant Biology 2024Quote: ... The SKI2 cDNA sequence was amplified from wild type cDNA using CloneAmp HiFi PCR Premix (Takara) and cloned into the pPZP212 binary vector ...
-
bioRxiv - Physiology 2024Quote: ... the full-length HA-TTL was amplified from the HA-TTL-IRES-dsRed plasmid using PrimeStar GLX Polymerase (Takara Clontech) and ligated into the NheI and BamHI restriction sites of VC206 ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-DsRed (Takara, #632496, 1:500) and chicken anti-beta-tubulin 3 (Aves Labs ...
-
bioRxiv - Developmental Biology 2024Quote: ... Membranes were UV cross-linked and pre-hybridized with ExpressHyb Hybridization Solution (Clontech) for 1 h at 50°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Lenti-X™ 293T Cell Line (Takara) was cultured in 90% DMEM with high glucose (4.5 g/L) ...
-
bioRxiv - Cell Biology 2024Quote: ... the cell culture medium contained the Tet-system-approved FBS (Takara). Recombinant six-histidine-tagged LLO and PLY was purified from E ...
-
bioRxiv - Neuroscience 2024Quote: ... and the SMARTer Stranded Total RNA-Seq Kit v2 Pico Input Mammalian (Takara Bio USA ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR with the SeqAmp PCR kit (Takara Bio USA, San Diego, CA). Unlike TARGET-Seq ...
-
bioRxiv - Cancer Biology 2024Quote: ... We used the SmartScribe kit (Takara Bio USA, San Diego, CA) for RT-PCR ...
-
bioRxiv - Biophysics 2024Quote: ... by In-Fusion (BD Clontech) cloning reaction56 ...
-
bioRxiv - Biochemistry 2024Quote: ... The recombinant SMC1A HD/RAD21C and SMC3 HD/RAD21N protein complexes were then purified by affinity chromatography using the 10xHis purification tag on RAD21 by incubating the cleared lysates with TALON Metal Affinity Resin (Takara Bio). The purification tag was then removed on the affinity beads by overnight 3C protease digestion at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Human full-coding KATNA1 cDNA was isolated from a human fetal brain Marathon-ready cDNA collection (Clontech, Invitrogen) with the following forward and reverse primers ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted using RNAiso Plus (Takara, Shiga, JPN, #9109) or ISOGEN II (NIPPON GENE CO. ...
-
bioRxiv - Physiology 2024Quote: ... the full-length HA-TTL was amplified from the HA-TTL-IRES-dsRed plasmid using PrimeStar GLX Polymerase (Takara Clontech) and ligated into the NheI and BamHI restriction sites of VC206 ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was isolated using chloroform extraction and transcribed into cDNA using Prime Script Reverse Transcriptase (Takara, Shiga, Japan, #2680B) at 1000 ng in a total volume of 20 µl following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... both FRB-Rab6 ires Rab5-FKBP-EGFP and FRB-Mini-Giantin ires-Rabex5-FKBP-EGFP derive from the pIRESneo3 (Clontech-Takara), FRB and FKBP fragments were obtained by digestion ...
-
bioRxiv - Cell Biology 2024Quote: ... both FRB-Rab6 ires Rab5-FKBP-EGFP and FRB-Mini-Giantin ires-Rabex5-FKBP-EGFP derive from the pIRESneo3 (Clontech-Takara), FRB and FKBP fragments were obtained by digestion ...
-
bioRxiv - Synthetic Biology 2024Quote: ... supplemented with 10% FBS (Takara 632180). LentiX cells (Takara 632180 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... LentiX cells (Takara 632180) were used to produce lentivirus ...
-
bioRxiv - Plant Biology 2024Quote: ... The expression vectors were then co-transformed into AH109 Saccharomyces cerevisiae (Clontech), by lithium acetate mediated transformation (Gietz and Schiestl ...
-
bioRxiv - Synthetic Biology 2024Quote: ... To amplify the canvas and activity-encoding regions on the recorder plasmid construct,0 5µL of culture sample was directly used in a 10µL PCR reaction using PrimeStar Max master mix (Takara Bio, San Jose, CA) under conditions recommended by the manufacturer ...