Labshake search
Citations for Takara Bio :
7501 - 7550 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... SMARTerR Stranded Total RNA-seq kit v2-Pico InputMammalian (Takara Clontech) was used ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1.67X First-Strand Buffer (Takara Bio, 639538), 1.67 μM TSO (Exiqon ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1.67 U/μl Recombinant RNase Inhibitor (Takara Bio, 2313B), 1.67X First-Strand Buffer (Takara Bio ...
-
bioRxiv - Developmental Biology 2022Quote: ... which was modified to obtain a CFP reporter cell line (rLV.EF1.AmCyan1-9 [0039VCT] Clontech, Takara Bio Europe). The LX2 cell line was maintained in DMEM ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the lens-specific cryaa:Cerulean marker using in-Fusion cloning (Takara Bio). We injected plasmid and Tol2 transposase RNA (5-10 ng/µL each ...
-
bioRxiv - Developmental Biology 2022Quote: ... Clontech Lenti-X Concentration (Takara 631232) solution was used to concentration the LV batches by adding 5.0 ml of Lenti-X Concentrator to 15.0 ml of supernatant (1:3 ratio) ...
-
bioRxiv - Developmental Biology 2022Quote: ... which was modified to obtain a CFP reporter cell line (rLV.EF1.AmCyan1-9 [0039VCT] Clontech, Takara Bio Europe). The LX2 cell line was maintained in DMEM ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected using a lentiviral vector containing tdTomato (rLV. EF1. tdTomato9, Clontech), according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR was performed using the SYBR Premix Ex Taq kit (TaKaRa Bio USA, San Jose, CA) and the CFX Connect real-time PCR machine (Bio-Rad ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR was done using the Terra™ PCR Direct PCR mix (Takara Bio, Kusatsu, Shiga Japan). Genotyping for Lhx2 was performed as described earlier (Mangale et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... Virus containing supernatant was collected and virus particles were concentrated by Lenti-X concentrator (Clontech Laboratories, CA) according to the manufacturer protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Titer of the lentiviruses was measured with a lentivirus titration kit (Takara Bio USA, San Jose, CA, USA). The same multiplicity of infection (MOI ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lysates were centrifuged (1h, 4°C, 14000 xg) and the soluble fraction was passed through 1mL of Talon Metal Affinity Resin (Clontech #635509). The resin was washed for four times with 4mL Wash Buffer (50mM Tris pH7.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was generated with a PrimeScript® RT reagent kit (Takara, CITY, STATE), and real-time RT-qPCR was performed with a Rotor-Gene SYBR Green PCR kit (Qiagen Inc. ...
-
bioRxiv - Cell Biology 2022Quote: ... The qRT-PCR analysis was performed using the Takara Bio SYBR Premix Ex Taq (Takara, Cat. # RR420A, JPN) and CFX096 (Bio-Rad) ...
-
bioRxiv - Cell Biology 2022Quote: ... incubated with Lenti-X concentrator (Clontech Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... 0.5 µL ExTaq polymerase (TaKaRa, Japan), 4 µL of 2.5 mM dNTP mix and 37.5 µL ddwater ...
-
bioRxiv - Microbiology 2022Quote: ... the coding sequences of DivIVA and its T19A and T19E mutant alleles were PCR amplified using sequence-specific primers (Table 1) and cloned at BamHI-KpnI sites in pDsRed plasmid (Clontech Inc.) yielding pDsD4A and pDsD4AT19A ...
-
bioRxiv - Microbiology 2022Quote: ... the GFP fragment was PCR amplified from pEGFP-N1 (Clontech) using specific primers to insert MluI/NotI restriction enzyme sites and ligated on those restriction enzyme sites into pCI-Neo (Promega) ...
-
bioRxiv - Microbiology 2022Quote: ... NIH) and then cloned into pLVX-IRES-zsGreen1 vector using an In-Fusion HD cloning kit (Clontech, Mountain View, CA, USA). The GAD mutant of ORF1 inactivating the polymerase was generated by QuikChange (Stratagene ...
-
bioRxiv - Microbiology 2022Quote: ... by In-Fusion cloning (Takara Bio Inc.), obtaining pF_195P-eGFP ...
-
bioRxiv - Microbiology 2022Quote: ... 250 nM rapalog (AP21967, Clontech, stored at −20 ° C as a 500 mM stock in ethanol ...
-
bioRxiv - Microbiology 2022Quote: ... gRNAs targeting the selected region of the CMV and bGH sequences (235-310 and 1917-2029, respectively in pEGFP-N3, Takara), were designed accordantly to each ROI (Table S3 and Supplementary Methods) ...
-
bioRxiv - Microbiology 2022Quote: ... and reverse transcript to cDNA by PrimeScrip RT reagent Kit (Takara cat #RR037A). The corresponding cDNAs were quantified by using Hieff qPCR SYBR Green Master Mix (Yeason cat #11202ES03) ...
-
bioRxiv - Microbiology 2022Quote: ... 0.3 μl of Taq polymerase (TaKaRa), 1 μl of dNTP mix (2.5 mM) ...
-
bioRxiv - Microbiology 2022Quote: ... and McGee_sabB_rev (5’ atcgataagcgaattcttaataagcaaacacataattgagatacacgctataaagc 3’) and cloned into the pDYC40 plasmid that contains a kanamycin resistance cassette 55 via In-Fusion cloning (Takara). This plasmid is designed for complementation at a previously characterized ...
-
bioRxiv - Microbiology 2022Quote: ... All DNA fragments were cloned into the respective vectors using an In-Fusion HD cloning kit (Clontech, Mountain View, CA, USA). All constructs or primers used to construct the HEV reporter genomes in Supplementary Table 1 have been validated through Sanger sequencing and are available upon request.
-
bioRxiv - Microbiology 2022Quote: ... PCR was carried out using Tks Gflex DNA Polymerase Low DNA (TaKaRa). The PCR cycling procedure was as follows ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplification was performed by using PrimeStar MAX (TaKaRa) and 14 specific primer sets tiling the genome of PaBV-4 (shown in Supplementary Table 1) ...
-
bioRxiv - Microbiology 2022Quote: ... Brain tissues from parrots were homogenized using a BioMasher V instrument (TaKaRa, Shiga, Japan) and centrifuged at 1,500 rpm for 10 min at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... the cDNA was transferred to pLVX-EF1alpha-IRES-Puro (Takara/Clontech) by classic restriction digest and ligation ...
-
bioRxiv - Microbiology 2022Quote: ... lentiviral particles were prepared using the Lenti-X™ Packaging system (Takara Bio). For the pLV-CMV-IRES-PuroR-T2A-mAmetrine vectors ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: ... the cDNA was transferred to pLVX-EF1alpha-IRES-Puro (Takara/Clontech) by classic restriction digest and ligation ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: ... Site-directed mutagenesis was carried out using Prime STAR Max Premix as described in the manufacturer’s instructions (Takara Bio). All of the flhA mutations were confirmed by DNA sequencing (Eurofins Genomics).
-
bioRxiv - Microbiology 2022Quote: ... These two amplified fragments were inserted into the pBh-EPS vector [46] at the PstI site using the In-FusionHD Cloning Kit (Takara). The resultant plasmid and Bsu36I-digested BmNPV-abb genome DNA [47] were cotransfected into BmN-4 cells using FuGeneHD (Promega) ...
-
bioRxiv - Microbiology 2022Quote: ... expressing Moloney murine leukemia virus gag and pol genes was co-transfected with pLNCX2 vector with the FLAG-APEX2-GARG1060 insert and a plasmid coding for the vesicular stomatitis virus envelope glycoprotein (Takara Bio) using Mirus 2020 DNA transfection reagent (Mirus) ...
-
bioRxiv - Microbiology 2022Quote: 1 μg of RNA was reverse transcribed into cDNA using Prime Script™ RT Reagent Kit with gDNA Eraser (Perfect Real Time) (RR047A, Takara-Bio) and then diluted 5-fold with nuclease-free water ...
-
bioRxiv - Microbiology 2022Quote: Retrovirus packaging cell line GP2-293 (Takara Bio) expressing Moloney murine leukemia virus gag and pol genes was co-transfected with pLNCX2 vector with the FLAG-APEX2-GARG1060 insert and a plasmid coding for the vesicular stomatitis virus envelope glycoprotein (Takara Bio ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA libraries were prepared with the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara, 634413). All samples were sequenced on Illumina NextSeq500 (Illumina).
-
bioRxiv - Genomics 2022Quote: ... cleaned up with NucleoMag NGS Clean-up and Size Select beads (Takara Bio), and ligated with the aforementioned triple-digested plasmid pool using T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Genomics 2022Quote: ... the primers used in this PCR carry partial Illumina adaptor sequences that permit indexing with Illumina dual-indexing primers in the second step PCR: after cleaning up with NucleoSpin Gel and PCR Clean-Up (Takara Bio), amplified barcodes were indexed using Q5 hot-start DNA polymerase (New England Biolabs ...
-
bioRxiv - Genomics 2022Quote: ... Individual colonies had their plasmids extracted using NucleoSpin Plasmid (Takara Bio) and Sanger sequenced to verify successful ligation with no sequence errors ...
-
bioRxiv - Genomics 2022Quote: ... 20 individual bacterial colonies were separately picked from a dilution plating and miniprepped using Nucleospin Plasmid (Takara Bio), and the extracted plasmids were Sanger sequenced to verify the cloning quality of the library ...
-
bioRxiv - Genomics 2022Quote: ... and cDNAs were generated with a PrimeScript RT Reagent Kit with gDNA Eraser (Takara). We performed qRT–PCR with TB Green Premix Ex Taq II (Takara) ...
-
bioRxiv - Genomics 2022Quote: ... and total RNA was extracted using RNAiso Plus (Takara, Dalian, China) according to the manufacturer’s protocols.
-
bioRxiv - Genomics 2022Quote: ... We performed qRT–PCR with TB Green Premix Ex Taq II (Takara). Relative expression was calculated using the 2−ΔΔCt method [105] ...
-
bioRxiv - Genomics 2022Quote: ... and elute was concentrated with NucleoSpin Gel and PCR Clean-Up (Takara Bio). The pooled samples were sequenced using 5 lanes of Illumina Nextseq 550 High-Output ...
-
bioRxiv - Systems Biology 2022Quote: ... living colors mouse anti-GFP (632681, Clontech, Mountain View, CA), goat anti-GFP (ab5450 ...