Labshake search
Citations for Takara Bio :
6701 - 6750 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... and SacI- (Takara Bio) digested pMpGWB203 (Ishizaki et al. ...
-
bioRxiv - Biochemistry 2022Quote: Restriction enzymes were from Takara or New England Biolabs ...
-
bioRxiv - Biochemistry 2022Quote: ... In-Fusion HD (Takara) mutagenesis was used to introduce specific mutants in the coding sequence of GYS1 ...
-
bioRxiv - Pathology 2022Quote: ... 5 ng of total RNA was used with the SMARTer Stranded Total RNA-Seq Kit v3 - Pico Input Mammalian (TAKARA, Japan), according to the manufacture’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1000 ng of total RNA was reversed transcribed using PrimeScript reverse transcriptase (#RR036Q, TaKaRa, China). The synthesized cDNA was used as a template to perform quantitative real-time (qRT)-PCR with TB Green® Premix Ex Taq™ (#RR420Q ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmids were transferred to pGADT7 and pGBKT7 vectors (Clontech) by LR reaction (Invitrogen).
-
Antigen-dependent inducible T cell reporter system for PET imaging of breast cancer and glioblastomabioRxiv - Synthetic Biology 2022Quote: ... Pantropic VSV-G pseudotyped lentivirus was produced via transfection of Lenti-X 293T cells (Clontech #11131D) with a pHR’SIN:CSW transgene expression vector and the viral packaging plasmids pCMVdR8.91 and pMD2.G using Mirus Trans-IT Lenti (Mirus #MIR6606) ...
-
bioRxiv - Biochemistry 2022Quote: ... Next 80 μl of a 50% slurry of Talon resin (Clontech) in binding buffer (25 mM HEPES ...
-
bioRxiv - Biochemistry 2022Quote: ... In-Fusion HD (Takara) mutagenesis was used to introduce specific mutants in the coding sequence of PTG ...
-
bioRxiv - Molecular Biology 2022Quote: ... Enrichment of mRNA and library preparation (Nextera XT, Clontech), library quantification (KAPA Library Quantification Kit Illumina ...
-
bioRxiv - Physiology 2022Quote: ... PCR reaction was conducted using SYBR qPCR Premix Ex Taq II Tli RNase H+ (TAKRR820W, Takara). Primer pairs are listed in supplementary table S2.
-
bioRxiv - Physiology 2022Quote: ... cDNA was generated and amplified using the Smart-SEQ HT Kit for low RNA input according to the manufacturer’s recommendations (Takara Bio), which was used for generating sequencing libraries with the Nextera XT kit ...
-
bioRxiv - Genomics 2022Quote: ... 16 µL 100x DAPI and 8 µL ICELL8 Second Diluent (Takara) were added and incubated 10 minutes at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... in the pEGFP-N1 vector (Clontech) to generate Mic60-EGFP or in the pGEX-6P-1 to generate GST-ORD5.
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... 0.25 ng to 10 ng of total RNA was used for cDNA library preparation using a kit suitable for RNA isolation at pico-molar concentrations (MARTer Stranded Total RNA-Seq Kit v2-Pico Input Mammalian) following manufacturer recommended protocol (Clontech/Takara Bio #635005). Sequencing was performed by the UM DNA Sequencing Core ...
-
bioRxiv - Cell Biology 2022Quote: ... The library was generated by using the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Clontech) with 1 μg RNA as input ...
-
bioRxiv - Cancer Biology 2022Quote: Full-length cDNAs were constructed using PCR amplification and subsequently inserted into the pLVX-IRES-neo vector (#632184; Clontech, CA, USA). The shRNA sequences were cloned into the pSIH1-puro vector (#26597 ...
-
bioRxiv - Cell Biology 2022Quote: ... AAV particles were isolated using AAVPro extraction solution (Clontech). After transduction with both CRISPR/Cas9 gesicles and AAV homology donor ...
-
bioRxiv - Cell Biology 2022Quote: ... and packaged using pHelper and pRC2-miR321 vectors (Clontech). AAV particles were isolated using AAVPro extraction solution (Clontech) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and quantitative qPCR was conducted using SYBR Green qPCR Master Mix (TaKaRa) on the 7500 Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Cancer Biology 2022Quote: ... Bacterial transformation was performed following standard protocols using Stellar competent cells (Takara). Mini- and MidiPreps (Macherey-Nagel ...
-
bioRxiv - Cancer Biology 2022Quote: RFP-NLS expressing iHFK cells were generated by transfecting with the RFP-NLS expression plasmids using Xfect transfection reagent (Takara Bio; 631317). Cells containing RFP-NLS plasmids were selected using 1 μg/ml puromycin ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviruses were generated in HEK293FT cells and concentrated using the Lenti-X-concentrator (Takara Bio).
-
bioRxiv - Cancer Biology 2022Quote: ... Two RNA samples derived from normal brain were purchased from Clontech Laboratories and BioChain respectively.
-
bioRxiv - Biophysics 2022Quote: ... TALON IMAC (Clontech) resin was added to the supernatant ...
-
bioRxiv - Cancer Biology 2022Quote: Genes in the Hippo pathway were subcloned into pLVX-puro vector (Takara, #632164) with HA- ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was generated by the PrimeScript RT reagent Kit (TaKaRa), and quantitative qPCR was conducted using SYBR Green qPCR Master Mix (TaKaRa ...
-
bioRxiv - Biochemistry 2022Quote: ... modified derivatives of pLVX-TRE3G-IRES (Takara) were engineered for constitutive expression by replacing the TRE3G element with a UBC promoter ...
-
bioRxiv - Biochemistry 2022Quote: ... The barcodes were introduced immediately after the Tae1 coding sequence via Gibson assembly cloning (In-Fusion HD Cloning Kit – Takara Bio). Our Next-Generation sequencing strategy comprised two stages ...
-
bioRxiv - Cell Biology 2022Quote: ... were PCR amplified from the full-length cDNAs and cloned into the NheI and BamHI or into the HindIII and BamHI restriction sites of the pEGFP-C2 vectors (Clontech), resulting in untagged soluble proteins or proteins tagged with a GFP fused to its N-terminus ...
-
bioRxiv - Cell Biology 2022Quote: ... SEPT2 constructs in pTRIP TRE Bi plasmids and all interface mutants in pTRIP TRE Bi plasmids were cloned using seamless cloning (In-Fusion HD Cloning Plus Kit from Takara Bio, 638910). All pcDNAs and all wild-type SEPT7 and SEPT9-containing constructs in pTRIP TRE Bi plasmids were generated with classical cloning ...
-
bioRxiv - Cell Biology 2022Quote: ... modified from pTRE-Tight-BI (Takara-Bio) (Koraichi et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 10% tetracycline-free FBS (Takara #631107) and penicillin-streptomycin (Gibco #15140122).
-
bioRxiv - Cell Biology 2022Quote: ... and LSK+ or LSK- RNA-seq libraries were prepared using SMART-Seq v4 Ultra Low Input RNA Kit (Takara, 634888) and KAPA HyperPrep kit (KAPA ...
-
bioRxiv - Cancer Biology 2022Quote: ... ATF4 cDNA was cloned into a doxycycline inducible pLVX (Clontech) vector ...
-
bioRxiv - Developmental Biology 2022Quote: Total mRNA was isolated using the RNAiso Plus reagent (Takara, Beijing, China) and reverse transcribed using the HiScript II 1st Strand cDNA Synthesis Kit with gDNA wiper (Vazyme ...
-
bioRxiv - Cell Biology 2022Quote: ... and transformants were selected on synthetic medium lacking uracil (Clontech, Mountain View, CA) at 30°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Transformants were selected on synthetic media containing yeast nitrogen base (YNB, Difco) supplemented with 2 % glucose and DropOut supplements lacking uracil (Clontech, Mountain View, CA). Single colonies were used to inoculate 5 mL liquid YNB media supplemented with 2 % glucose and DropOut supplements lacking uracil ...
-
bioRxiv - Pathology 2022Quote: ... PCR was performed using Quick Taq HS DyeMix (Toyobo, Osaka, Japan) and a PCR Thermal Cycler Dice (TP650; Takara Bio Inc., Shiga, Japan), with the following cycling conditions ...
-
bioRxiv - Biochemistry 2022Quote: Total RNA was extracted using RNAios Plus reagent (TaKaRa, Kusatsu, Japan), and 28s/18s rRNA ratios were analyzed by Agilent 2100 (Agilent Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... The induction of His-and GST-fusion proteins and their subsequent purification using TALON® Metal Affinity Resin (Clontech Laboratories) and Glutathione SepharoseTM 4 Fast Flow beads (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2022Quote: c-Kit-EGFP fusion protein: chicken c-Kit cDNA was inserted into multiple cloning site of pEGFP-N1 Vector (Clontech, #6085-1) including EGFP sequences using a primer set ...
-
bioRxiv - Biochemistry 2022Quote: Overall RNA was separated via RNAiso Plus as per the supplier’s protocols (TaKaRa, Japan). cDNA was produced from 2 mg overall RNA with AMV reversed transcriptive enzyme (TaKaRa ...
-
bioRxiv - Biochemistry 2022Quote: ... qRT-PCR was completed via the Power SYBR Green Master Mix (TaKaRa) and an ABI 7300 real-time PCR identification apparatus (Applied Biosystem ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNA was produced from 2 mg overall RNA with AMV reversed transcriptive enzyme (TaKaRa) as per the supplier’s instruction ...
-
bioRxiv - Developmental Biology 2022Quote: ... Genomic DNA extraction for the prime edited DF1 or PGCs was carried out with NucleoSpin Tissue XS (TAKARA) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... along with a linear selection marker of hygromycin using Xfect (Clontech). These cells were cultured in a medium containing 200 µg/mL G418 sulfate (Santa Cruz Biotechnology) ...
-
bioRxiv - Biochemistry 2022Quote: A HeLa-T-PFK1-mEGFP stable cell line (hereafter, HeLa-T-PFK1G) was generated using the HeLa Tet-On® 3G inducible expression system (Clontech) according to the manufacturer’s protocol ...