Labshake search
Citations for Takara Bio :
5401 - 5450 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... This (DNA-free) RNA was reverse transcribed into cDNA by using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Japan). Quantitative PCR was performed using a LightCycler 480 (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... the amplified DNA fragments were self-ligated using the In-Fusion HD cloning kit (TAKARA, Japan) to generate pET15-SmaI.
-
bioRxiv - Microbiology 2023Quote: ... the amplified fragment was incorporated into the Bam HI site of pHSG396 using the In-Fusion HD cloning kit (TAKARA, Japan), resulting in the generation of pHSG396-ptrA.
-
bioRxiv - Microbiology 2023Quote: ... These three amplified fragments were then seamlessly integrated into the Sac I site of YEP352-GAPII (Oka et al. 2007) using the In-Fusion HD Cloning Kit (Takara). Similarly ...
-
bioRxiv - Microbiology 2023Quote: ... packaging cells were transfected with expression vectors (pMSCVneo-fePit1, pMSCVneo-fePit2, or pMSCVneo empty vector) using the TransIT®-293 reagent (Takara, Kusatsu, Japan). Two days later ...
-
bioRxiv - Microbiology 2023Quote: ... and RNase inhibitor (final concentration of 0.1 U/μL) (Takara, #2313A). Lysates were incubated with anti-Flag (M2 monoclonal antibody ...
-
bioRxiv - Microbiology 2023Quote: ... The In-Fusion HD cloning kit (Clontech) was used for cloning according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... using oligo-dT primer (#3805, Takara, Shiga, Japan). A quantitative (q)PCR was performed on a Thermal Cycler Dice Real Time System (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... coli StellarTM cells (Takara Bio). The next day ...
-
bioRxiv - Microbiology 2023Quote: ... Gibson assembly was performed using either the Infusion kit (Takara Bio) or the NEB HiFi Assembly kit (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... and was cloned into pT2/HB vector through In-Fusion HD Cloning Plus kit (Takara Bio) following manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... and cloned into pcDNA3.1 plasmid using In-Fusion cloning (Clontech). YAP1 and Mid1 with C-terminal Flag were synthesized (GenScript ...
-
bioRxiv - Molecular Biology 2023Quote: ... A bacterial neomycin phosphotransferase gene (U55762) from the pEGFP-NI vector (Clontech) was used to generate control dsRNA ...
-
bioRxiv - Neuroscience 2023Quote: ... LRP10 sequence-verified cDNA was subcloned from the pcDNA™3.1-LRP10-V5-His-TOPO® plasmid (Quadri et al., 2018) into the pLVX-EF1α-IRES-mCherry plasmid (Takara Bio, 631987) via Gibson Assembly® (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... pGADT7 plasmids encoding the effector domain of different ZiF were co-transformed into chemically competent Y2HGold cells (Takara Bio, USA) with a pGBKT7 plasmid encoding OsExo70F3 in using a Frozen-EZ Yeast Transformation Kit (Zymo research).
-
bioRxiv - Plant Biology 2023Quote: ... and terminator was assembled into the backbone PCB1532 via In-Fusion cloning (In-Fusion cloning kit, Clontech Laboratories).
-
bioRxiv - Plant Biology 2023Quote: ... Genomic DNA was removed using DNase I (TaKara). RNA-seq transcriptome libraries were prepared using the TruSeq RNA sample preparation kit from Illumina ...
-
bioRxiv - Plant Biology 2023Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal and supplemented with 0.2 µg/ml Aureobasidin A (Takara Bio, USA). Plates were imaged after incubation for 60–72 hr at 30 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... with SYBR premix ExTaq (Tli RNaseH Plus) Rox Plus (Takara Bio Inc). Enrichment in each sample was calculated relative to the input and expressed in percentage.
-
bioRxiv - Synthetic Biology 2023Quote: ... VH and VL segments were ordered as gene blocks from Integrated DNA Technologies and were cloned into linearized CMV/R backbones with 5× In-Fusion HD Enzyme Premix (Takara Bio).
-
bioRxiv - Plant Biology 2023Quote: ... with SYBR premix ExTaq (Tli RNaseH Plus) Rox Plus (Takara Bio Inc). All relative expression levels were calculated following Hellemans et al ...
-
bioRxiv - Plant Biology 2023Quote: ... ProTT15 was digested by SalI-SmaI and cloned at the SalI-SmaI sites of the pBI101 binary vector (Clontech, USA) for plant transformation ...
-
bioRxiv - Biochemistry 2023Quote: The full-length SKP1-FBXO22 fusion protein with a 3xGGGS-linker was cloned into a pNic-Bio2 vector that encodes for an N-terminal His-tag as well as a C-terminal Avi-tag (GenBank: JF912191) using an In-Fusion HD Cloning System kit (Takara), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... or TransIT-LT1 (Takara, Cat# MIR2300) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cDNA was synthesized from 100 µg of total RNA by Prime ScriptTM RT reagent kit with gDNA Eraser (Takara, Tokyo, Japan). Each cDNA sample was amplified for the gene of interest and β-actin in a 15 µL reaction volume TB GreenTM Premix Ex Taq™ II (Takara ...
-
bioRxiv - Plant Biology 2023Quote: ... qPCR reactions were implemented in an Applied Biosystems 7500 Real-Time PCR system with the SYBR® Premix Ex TaqTM II (TAKARA). ACTIN was used as the reference gene for qPCR analyses ...
-
bioRxiv - Molecular Biology 2023Quote: ... Virus was concentrated 100 times by Lenti-X Concentrator (Takara) after filtering through a 0.45 syringe filter ...
-
bioRxiv - Plant Biology 2023Quote: ... Primers flanking the region targeted for replacement were designed and used for Terra Direct genotyping PCR (Clontech) to identify transformants lacking the wild-type fragment ...
-
bioRxiv - Plant Biology 2023Quote: ... The amplified cDNA was inserted downstream of the CaMV 35S promoter in the modified pRI201-AN vector using In-Fusion Cloning technology (Takara). Agrobacterium tumefaciens strain C58 ...
-
bioRxiv - Plant Biology 2023Quote: ... we employed a modified pRI201-AN vector (Takara, Kyoto, Japan) in which the NPTII gene was substituted with the HPT gene ...
-
bioRxiv - Plant Biology 2023Quote: ... A genomic fragment containing the promotor region and full-length coding region of ATPC1 (At4g04640) was amplified from Col-0 genomic DNA by PCR using PrimeSTAR DNA polymerase (TaKaRa) and the primers ATPC1_F (CACCCATGGAGAGGGCTCGTACCTTAC ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sequencing libraries were created following the protocol described in the SMARTer® smRNA-Seq Kit for Illumina user manual (Takara Bio).
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was prepared from equal amounts of RNA using PrimeScript RT Reagent Kit (Takara, RR037A) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Competent yeast cells (Y2H Gold, Clontech) were co-transformed with the two vectors using a polyethylene glycol (PEG ...
-
bioRxiv - Plant Biology 2023Quote: ... The extracted RNA was treated with Recombinant DNase I (2270A, Takara, Shiga, Japan), and 2 ng equivalent was synthesized using Super Script 3 Supermix (18080400 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Each cDNA sample was amplified for the gene of interest and β-actin in a 15 µL reaction volume TB GreenTM Premix Ex Taq™ II (Takara, Tokyo, Japan). The PCR conditions were 95 °C for 30 s followed by 40 cycles of 95 °C for 5 s and 60 °C for 60 s ...
-
bioRxiv - Plant Biology 2023Quote: ... This vector has inherited an unique AscI restriction site from pENTR/D-TOPO that was used together with SpeI restriction site to linearize the vector and clone the proJAGGER:JAGGER-cYFP construct using In-Fusion HD Cloning Plus (Clontech). For the mutant constructs used in this study ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized from 500 ng RNA using a Primescript RT Reagent Kit (Takara Bio, Shiga, Japan) with random hexamer and oligo(dT ...
-
bioRxiv - Plant Biology 2023Quote: Yeast two-hybrid screening was performed using the Matchmaker Gold Yeast Two-Hybrid System (Takara). The cDNA fragments corresponding to CEPDL2 and GrxS5 were subcloned into the pGBKT7 vector ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was isolated from Arabidopsis leaves with the RNAiso Plus (TAKARA), and reverse transcribed by the PrimeScript™ RT reagent Kit (TAKARA) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Synthesis of cDNA using reverse transcriptase was performed with the RNA to cDNA EcoDry Premix kit (Takara Bio, San Jose, CA; 639549) and and the subsequent quantitative PCR using PowerSYBR Green (Applied Biosystems - Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... primary mouse cortical neurons were transfected with pEGFP-C1 vector (Clontech) at 3 days in vitro (DIV ...
-
bioRxiv - Plant Biology 2023Quote: ... One microgram of total RNA was used to synthesize cDNA using Oligo dT primers and Smart MMLV Reverse Transcriptase kit (Takara Bio Inc, Shiga, Japan). The expression of NIa-Pro was verified in all samples using gene specific primers and RT-PCR (Fig S1a ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmids were transformed into Stellar competent cells (Takara Bio), and transformed cells were plated and grown at 37 °C overnight ...
-
bioRxiv - Plant Biology 2023Quote: ... We modified the recombination vector by using In-Fusion (Clontech) to insert the Gateway L1-L2 site into pJHY-TMp1 linearized by digestion with PacI ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates were then cleared by centrifugation at 12,000xg for 12 minutes and added to 1ml of pre-equilibrated TALON metal affinity resin (Takara Bio, 635502). The slurry was rotated at 4°C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNAs were synthesized using PrimeScript RT Mastermix (Takara Bio Inc., Japan) and used as templates for qRT-PCR analysis using LightCycler 480 (Roche ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR fragments of AGB1.x were ligated into the pGBKT7 DNA BD vectors (Takara Bio USA, CA, USA) and AGGs into the pGADT7 AD vector (Takara Bio ...
-
bioRxiv - Plant Biology 2023Quote: ... and standard PCR was performed using ExTaq HS kit (TaKaRa). Control reactions were run using wild-type DNA as a template.
-
bioRxiv - Synthetic Biology 2023Quote: ... The SEAP transgene from our previously developed plasmid pSurvivin-SEAP-WPRE (REF) was cloned into pHR_5x GAL4 UAS using In-Fusion HD cloning (Takara Bio, CA, USA) to make pHR_5x Gal4 UAS SEAP ...