Labshake search
Citations for Roche :
3751 - 3800 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... We incorporated sample-specific dual-indexed adapters to library fragments (Glenn et al., 2019) by PCR amplifying the resulting libraries using HiFi Hotstart ReadyMix (Kapa Biosystems, Inc.) and 8-12 PCR cycles following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... The beads were magnetically separated as above and pooled eluate added to PCR strip tubes containing 2X KAPA HiFi HotStart ReadyMix (Roche, Cat# 07958935001) and 2 mM each of P5 (AATGATACGGCGACCACCGAGATCTACA*C ...
-
bioRxiv - Microbiology 2023Quote: ... we amplified the V3-V4 hypervariable region of the 16S rRNA gene via PCR with Hifi Hotstart Readymix (Kapa Biosystems; Boston, MA), forward primer 5’-TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG CCT ACG GGN GGC WGC AG-3’ ...
-
bioRxiv - Microbiology 2023Quote: ... Abutting primer pairs were designed that were specific to these genetic groups (Supplementary Table 3) to enable the recovery of full viral genomes using polymerase chain reaction (PCR) with HiFi HotStart DNA polymerase (Kapa Biosystems, USA) using cycling conditions per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The qPCR was performed using PerfectStartTM Green qPCR Super Mix (TransGen Biotech, 1) on a Real-time PCR Detection System (Roche, LightCycle480 II). RPLP0 served as an internal control ...
-
bioRxiv - Immunology 2023Quote: ... The molarity of adapter-modified molecules was defined by quantitative PCR using the Kapa Biosystems Kapa Library Quant Kit (Roche, cat#07960140001). Individual libraries were normalized to 5 nM in preparation for Illumina sequence analysis and sequenced on a NovaSeq 6000 with a paired-end 150 cycle sequencing run.
-
bioRxiv - Molecular Biology 2023Quote: We designed a multiplex quantitative PCR (qPCR) with four parallel assays to be run on the Roche 480 light cycler (Roche, Basel, Switzerland). Compatible fluorescent dyes (FAM ...
-
bioRxiv - Physiology 2023Quote: ... The cDNA was analyzed using real-time PCR with THUNDERBIRD SYBR qPCR Mix (TOYOBO) and a LightCycler 96 instrument (Roche, Basel, Switzerland), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... this PCR was performed in eight reactions of 25 μl (200 μl total) using 150 ng of 4C-template per reaction and the Expand Long Template PCR System (Roche, Basel, Switzerland) (Supplementary Tables 3 and 4) ...
-
bioRxiv - Genetics 2023Quote: ... Quantitative PCR (qPCR) was performed on a LightCycler® 480 instrument using LightCycler® 480 SYBR® Green I Master mix (Roche), as per manufacturers protocol ...
-
bioRxiv - Genomics 2023Quote: ... The cDNA was amplified by combining 25 μL of the silane purified product with PCR master mix (25 μL 2X Kapa HotStart Mix (Kapa Biosystems #KK2602), 2 μL of 5 μM SMART PCR primer ...
-
bioRxiv - Biochemistry 2023Quote: ... Sequencing libraries were validated on the Agilent TapeStation and quantified using Qubit 2.0 Fluorometer as well as via quantitative PCR (KAPA Biosystems, Wilmington, MA). Sequencing libraries were clustered on a single lane of a flowcell and loaded onto an Illumina HiSeq 4000 instrument ...
-
bioRxiv - Cell Biology 2023Quote: ... Synthesized oligonucleotides (Twist Biosciences, South San Francisco, CA) were PCR-amplified for 10 cycles using KAPA HiFi HotStart DNA Polymerase (Roche, Basel, Switzerland) with 52 °C annealing and 15 s extension ...
-
bioRxiv - Molecular Biology 2023Quote: ... For this 2 µl of RNA sample were mixed with the PCR ingredients of the one-step LightCycler 480 RNA Master Hydrolysis Probes kit (Roche Holding AG), the JFH1-specific probe (5’-6FAM-AAA GGA CCC AGT CTT CCC GGC AA-TMR-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR analysis was carried out using the qScript One-Step PCR kit (Quanta Biosciences, Gaithersburg, MD) on a LightCycler 96 System (Roche, Indianapolis, IN). Fold-change values were calculated using the 2-ΔΔCt method ...
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative reverse transcription polymerase chain reaction (qRT– PCR) was performed in optical 96-well plates via the LightCycler 480 II system (Roche Life Science) using KOD SYBR qPCR Mix (Toyobo) ...
-
bioRxiv - Neuroscience 2024Quote: ... A DNA library targeting polyadenylated transcripts was constructed for each sample in a 12-cycle PCR (100ng total RNA, KAPA hyper mRNA stranded library prep kit, Roche, catalogue# KK8581). Final cDNA libraries were checked for quality by TapeStation and qPCR (Kapa’s library quantification kit for Illumina Sequencing platforms ...
-
bioRxiv - Evolutionary Biology 2024Quote: A PCR free Illumina library (based on the same HMW extraction) was prepared using the Kapa Hyper Prep Kit (Roche, Basel, Switzerland), following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR reactions were carried out on 2 µL of cDNA using 7 µL of FastStart SYBR Green Master Mix (Roche, Basel, Switzerland), 2 µL of ddH2O (Roche ...
-
bioRxiv - Plant Biology 2024Quote: ... The relative expression of genes in leaves was determined by reverse transcription quantitative PCR performed on an Applied Biosystems StepOne Real-Time PCR System with KAPA SYBR® FAST qPCR Master Mix (2X) Kit (Kapa Biosystems) according to the protocol of the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qRT-PCR analysis was conducted using a LightCycler 480 Real-Time PCR System and LightCycler 480 SYBR Green I Master mix (Roche Applied Science, Germany). 18S RNA (adult tissue and embryonic-early larval samples ...
-
bioRxiv - Developmental Biology 2020Quote: ... was used to recover and then amplify the converted DNA fragments through PCR with a maximum of 12 cycles with Kapa HiFi U+ Master Mix (Kapa Biosystems, cat.: KK2801). Barcodes were introduced during this process.
-
bioRxiv - Immunology 2022Quote: ... qPCR for the markers below was performed with Applied Biosystems™ 7500 Real-Time PCR System (Waltham, Massachusetts, USA) using FastStart Essential DNA Green Master (Roche, Basel, Switzerland) and the following QuantiTect Primer Assay (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative RT-PCR (qRT-PCR) reaction was performed using cDNA with SYBR green fast mix (Quantabio, PerfeCTa, 95072-012) on a Roche lightcycler (Roche, LightCycler 480 II). The following primers used for qRT-PCR ...
-
bioRxiv - Microbiology 2019Quote: ... a quantitative real-time PCR was carried out in duplicate with a LC 480 SYBR Green QPCR Master Mix (Roche Diagnostics, Mannheim, Germany) in a light Cycler 2.0 system instrument ...
-
bioRxiv - Molecular Biology 2019Quote: ... that amplify the coding sequence of the phytoene desaturase gene (tetur01g11270) (Table S1. PCRs were performed using the Expand Long Range dNTP Pack (Roche/Sigma-Aldrich, Belgium). Reaction mixtures were prepared according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... HCMV glycoprotein B gene (gB) in the DNA sample was amplified in Lightcycler 480 real time PCR platform (Roche Molecular System, Pleasanton, CA) using TaqMan probe (LightCycler TaqMan Master ...
-
bioRxiv - Neuroscience 2020Quote: ... reverse-transcribed into first-strand cDNA and quantitative PCR (qPCR) amplification was performed in 96-well plates in a Mastermix for probes (Roche, Burgess Hill, UK) and run on a LightCycler® 96 System (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... The molarity of adapter-modified molecules was defined by quantitative PCR using the Kapa Biosystems Kapa Library Quant Kit (Kapa Biosystems Cat#KK4824).
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative real-time PCR (qPCR) analysis of the cDNAs was carried out using the LightCycler® 480 SYBR Green I Master (Roche Life Science) and the products were detected by Roche LightCycler LC480 Real-Time PCR instrument ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative real time PCRs (qPCRs) were performed in a total volume of 10 μl with Kapa SYBR Fast qPCR kit (KAPA Biosystems, Wilmington, MA) on an ABI 7500 fast machine operated with ABI 7500 software (Applied Biosystems) ...
-
bioRxiv - Paleontology 2022Quote: ... The final libraries were quantified on an Applied Biosystems™ QuantStudio™ 7 Flex Real-Time PCR System using the KAPA SYBR® FAST ROX Low qPCR Master Mix for Illumina platforms (KAPA Biosystems, KK4873). DNA extracted from mammoth and sloth boluses were sequenced on an Illumina MiSeq using the 600-cycle v3 kit (Illumina ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The qRT-PCR was performed with the Hieff® qPCR SYBR® Green Master Mix (Yeasen, China) and a LightCycler 480 II Instrument (Roche, Switzerland). Six biological replicates and three reaction replicates for each group were used ...
-
bioRxiv - Molecular Biology 2021Quote: ... sections were fixed with 4% PFA (PierceTM, 28908) in PBS for 15 minutes at room temperature and permeabilized with PCR grade recombinant Proteinase K (Roche Applied Science, 3115887001) for 30 minutes at 37 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... Real-time quantitative PCR assays were performed using the KOD SYBR® qPCR Mix (TOYOBO) on the Light Cycler 96 system (Roche Diagnostics, Germany). ΔCt method was used for estimating transcript abundance ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 12.5 ng of purified DNA from each sample was used as a template for PCR amplification in 25 μl reaction mixture by using 2 × KAPA HiFi Hot Start Ready Mix (Kapa Biosystems, MA, USA). For PCR amplification ...
-
bioRxiv - Neuroscience 2019Quote: ... Genotyping of the OXTR SNPs was performed by real-time polymerase chain reaction (PCR) and subsequent melting curve detection using a Cobas Z 480 Light Cycler (Roche Diagnostics, Mannheim, Germany). With the melting curve analyses ...
-
bioRxiv - Genomics 2019Quote: ... and 5 refers to the CRE Number and Affinity library) and with KAPA HiFi HotStart Real-time PCR Master Mix (2X) (Kapa Biosystems, Wilmington, MA) following the recommended cycling protocol at 14 cycles ...
-
bioRxiv - Molecular Biology 2019Quote: ... and an equimolecular pool of libraries was prepared and titrated by qRT-PCR using the “Kapa-SYBR FAST qPCR kit forLightCycler480” (Kapa BioSystems, Fritz Hoffmann-La Roche, Basilea, Switzerland) and a reference standard for quantification (Genomics Unit ...
-
bioRxiv - Plant Biology 2019Quote: ... approximately 100 ng of CTAB-extracted gDNA from PI 89772 (rhg1-a) was PCR amplified for 35 cycles using HiFi polymerase (KAPA Biosystems, Wilmington, MA). Primer annealing was at ∼70°C for 30 seconds and extension was at 72°C for 5 minutes ...
-
bioRxiv - Genetics 2020Quote: ... Real-time PCR was performed with a LightCycler® 480 II and a LightCycler®480 SYBR Green I Master (Roche, Basel, Switzerland). The relative expression level of the CRISPR mRNA was standardized using GAPDH expression ...
-
bioRxiv - Cancer Biology 2020Quote: ... The libraries were quality controlled on an Agilent 2100 Bioanalyzer with the DNA 7500 assay for size and the concentration was estimated using quantitative PCR with the KAPA Library Quantification Kit Illumina® Platforms (Roche Kapa Biosystems). To obtain sufficient amount of libraries for sequencing it was necessary for the low input libraries (0,1 - 0,2 ug ...
-
bioRxiv - Microbiology 2020Quote: ... 8.4 μL of PCR Probe water and 10 μL of the 2x commercial reaction mixture (SYBR® Green Master Mix, Bio-Rad. A LightCycler96® (Roche) device was used and PCR conditions applied were ...
-
bioRxiv - Genetics 2022Quote: ... Sense and antisense digoxigenin (DIG)-labeled probes were synthesized from the purified PCR product using DIG RNA Labeling Kit (Roche, cat. no.11175025910). All primer sequences were listed in Supplementary Information (Supplementary Table 3).
-
bioRxiv - Microbiology 2022Quote: ... All reactions were performed in duplicate using a real-time PCR system (LightCycler 96 System; F. Hoff Mann-La Roche Ltd., Basel, Switzerland). PCR amplification was performed as previously described (16) ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Microbiology 2023Quote: First-strand cDNA synthesis and quantitative real-time PCR was performed using the KAPA SYBR® FAST kit (CliniSciences) on the LightCycler® 480 (Roche Diagnostics) using the primers indicated in Supplementary Table S6 ...
-
Neutralizing gut-derived lipopolysaccharide as a novel therapeutic strategy for severe leptospirosisbioRxiv - Microbiology 2024Quote: The leptospiral burdens in organs were determined by quantitative PCR using an Applied Bioscience 7500 thermocycler and FastStart Universal SYBR green Master (Roche Applied Science, Germany). The specimens (0.09 to 0.15 g ...
-
bioRxiv - Biochemistry 2023Quote: ... The target loci of interest were PCR-amplified from 100 ng genomic DNA using KAPA HiFi HotStart Uracil+ Ready Mix (Kapa Biosystems, Cat # KK2602) or Phusion High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... 50ng of gDNA was used as template per sample in each reaction and 35 cycles of PCR amplification were performed with KAPA HiFi HotStart Ready Mix (2x, KAPA Biosystems, Wilmington, MA). Multiplexed PCR reactions were purified using a 2X volume ratio of KAPA pure SPRI beads (KAPA Biosystems ...