Labshake search
Citations for Roche :
3451 - 3500 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The concentration of viral genomes (vg/ml) was determined by quantitative real-time PCR on a LightCycler480 (Roche diagnostic, France) by using TaqMan probe ...
-
bioRxiv - Plant Biology 2021Quote: ... Expression levels of germination-associated genes were measured by qRT-PCR analysis using LightCycler 480 SYBR Green I Master mix (Roche) in a LightCycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Templates for riboprobes were designed by attaching a T7 promoter through PCR and performing a DIG labelled transcription reaction (Roche). The same H ...
-
bioRxiv - Developmental Biology 2021Quote: Pitx1 WISH were performed on 40-45 somite stage mouse embryos (E12.5) using a digoxigenin-labeled Pitx1 antisense riboprobe transcribed from a cloned Pitx1 probe (PCR DIG Probe Synthesis Kit, Roche), as previously described in (Kragesteen et al ...
-
bioRxiv - Developmental Biology 2021Quote: ... 9 and 12h node induced and contralateral uninduced tissues were dissected in ice cold 1x PBS and transferred to low binding PCR tubes containing 1x Protease Inhibitor Cocktail in 1xPBS (cOmplete mini EDTA-free; Roche) on ice ...
-
bioRxiv - Biophysics 2020Quote: ... Beads in the sample and control fractions were then pulled down and the looping buffer was replaced with 50 μl of PCR mix (25 μl 2x HiFi KAPA Hot Start ready mix (Roche), 1 ul each of 100 μM primers (supplementary note 1) ...
-
bioRxiv - Genetics 2021Quote: We extracted DNA from nail samples using the ISOHAIR (Nippon Gene) and oral mucosa samples using the High Pure PCR Template Preparation Kit (Roche).
-
bioRxiv - Genomics 2021Quote: ... was performed with NZY Speedy qPCR Green Master mix (NZY tech) and in a LightCycler 480 Real-Time PCR System (Roche). Primer sequences are detailed in the Supplementary Table S8 ...
-
bioRxiv - Neuroscience 2021Quote: ... the circular DNA fragment containing the shotV104 breakpoint region was amplified using a High Fidelity PCR Kit (Eppendorf and Roche). PCR products were gel-extracted ...
-
bioRxiv - Cancer Biology 2021Quote: ... The let-A and I1B fragments were amplified from S2 cell genomic DNA using the Expand Long Template PCR System (Roche) and cloned in pBacPAK8_EGFP under a metallothionein promoter ...
-
bioRxiv - Genomics 2019Quote: ... Genome libraries were prepared using the KAPA Hyper Library Preparation Kit with Standard PCR Library Amplification (Kapa Biosystems, Wilmington, MA) and sequenced on an Illumina MiSeq using V3 sequencing chemistry (Illumina Inc. ...
-
bioRxiv - Microbiology 2021Quote: ... Radiolabeled probe was generated by purifying a digested (Ncol; 1 cut) pCpG vector DNA using High Pure PCR product Purification Kit (Roche) followed by radiolabeling the probe using Random Prime DNA labeling kit (Roche) ...
-
bioRxiv - Plant Biology 2021Quote: ... Two µL of diluted cDNA was used as a template for the qRT-PCR with Fast SYBR Green Master Mix (Roche) on a Light-Cycler 96 instrument (Roche ...
-
bioRxiv - Immunology 2020Quote: ... The abundance of transcripts from the genes of interest was measured by quantitative real-time PCR with the Light Cycler 480 II system (Roche) with a Brilliant III SYBR master mix (Agilent ...
-
bioRxiv - Molecular Biology 2021Quote: ... the cDNA samples were amplified using LightCycler® 480 SYBR® Green 2x PCR Master Mix I (Roche, Cat# 04887352001) and 0.3 or 0.6 μM of forward and reverse primer respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... The bisulfite-treated DNA was amplified by nested PCR (Supplementary Table 2) using KAPA HiFi HS Uracil+ ReadyMix (Kapa Biosystems). In the first and second rounds of PCR ...
-
bioRxiv - Immunology 2020Quote: ... followed by adaptors P1 (AATGATACGGCGACCACCGA) and P2 (CAAGCAGAAGACGGCATACGA) were added by limited cycle PCR using the KAPA HiFi Hot Start Ready Mix (Roche). PCR products were purified using AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Immunology 2021Quote: The PE+ and PE− fractions were processed identically in a two-step PCR procedure using KAPA HiFi HotStart ReadyMix (Roche). The protocol for the two-step PCR approach was adopted and modified from a previously described method63 ...
-
bioRxiv - Genomics 2021Quote: Bisulfite converted DNA was amplified and barcoded in 50 µL PCR reaction (22 µL bisulfite-converted DNA, 25 µL 2× KAPA HiFi HotStart Uracil+ ReadyMix (Roche), 1.5 µL 10 µM i5 universal PCR primer ...
-
bioRxiv - Genomics 2020Quote: ... and the ligation products were subjected to PCR amplification following instructions from the KAPA HiFi HotStart ReadyMix (KAPA BIOSYSTEMS, KK2602). A total of 6 cycles (95°C 3 min ...
-
bioRxiv - Genetics 2020Quote: ... exons and approximately 150 bp of flanking introns were amplified using the Expand high fidelity PCR system (Roche, Basel, Switzerland). Amplicons were subsequently cloned into the pCAS2 vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reactions were diluted 5 times in water before quantitiative real-based protocol time PCR on a LightCycler LC480 (Roche), using SYBR-based protocol based Mesa Blue qPCR Mastermix (Eurogentec ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-Time qRT-PCR was performed using the Real-Time 2xHS-PCR Master Mix Sybr B (A&A Biotechnology) on a LightCycler 480 II qPCR System (Roche) with custom-designed primers for Gli1 (Fwd ...
-
bioRxiv - Immunology 2022Quote: ... and 11-week infected half brains and liver lobes of mice (n=4/group) was extracted and purified using a High Pure PCR Template Prep Kit (Roche). DNA concentration of each sample was determined via NanoDrop ...
-
bioRxiv - Cell Biology 2022Quote: Following library construction as per manufacturer’s instructions ST libraries were quantified using the KAPA-Illumina PCR quantification kit (KAPA Biosystems) and pooled at 4nM concentration with a sample ratio corresponding to the surface area of tissue coverage obtained from the H&E imaging ...
-
bioRxiv - Cancer Biology 2022Quote: 1 μL amplified cDNA library was used as template in a 29-cycle PCR reaction using KAPA HiFi HotStart ReadyMix (Roche). To avoid possible PCR-induced library biases ...
-
bioRxiv - Molecular Biology 2022Quote: ... Probe labelling and DNA hybridization were performed following the protocol provided with the PCR-DIG DNA-labelling and chemiluminescent detection kit (Roche).
-
bioRxiv - Cancer Biology 2022Quote: The activity of telomerase in the cell lines was detected using the TeloTAGGG telomerase PCR ELISA Kit (Roche, Cat# 12013789001). The assay was performed according to the manufacturer’s instructions and repeated in triplicate ...
-
bioRxiv - Immunology 2022Quote: ... Silent point mutations and non-cleavable point mutants were generated by quick-change PCR using Kapa high-fidelity DNA polymerase (Roche) and all mutations were verified by sequencing.
-
bioRxiv - Immunology 2022Quote: SHM analysis was either performed by cloning followed by classical Sanger method as described (Rouaud et al, 2013) or performed directly on PCR products by next generation sequencing using GS Junior (Roche) or Ion Proton system (Applied Biosystem) ...
-
bioRxiv - Genomics 2022Quote: ... and P5 and P7 adapters were ligated per pool following the KAPA HiFi Hotstart PCR kit standard protocol (Kapa Biosystems). Pooled samples were then combined into one sample and cleaned as before ...
-
bioRxiv - Microbiology 2022Quote: ... the ligated product was amplified by 12 PCR cycles using the Kapa Hifi Hotstart NGS library amplification kit (Kapa Biosystems), followed by purification with 0.6×AMPure XP ...
-
bioRxiv - Plant Biology 2022Quote: ... and 72°C for 20 s) containing the Spartina cDNAs with the PCR DIG Probe Synthesis Kit (Roche, Cat.11636090910) using the SaHKT1 transcripts specific primers (Forward primer ...
-
bioRxiv - Microbiology 2022Quote: ... 33.75 µL cells were mixed with a PCR master mix containing 37.5 µL KAPA HiFi HotStart ReadyMix (Roche, CN KK2602), 2.25 µL second strand synthesis primer SMRT_dT (10 µM ...
-
bioRxiv - Microbiology 2022Quote: A labeled DNA probe for the new virus derived from Mr was prepared using a commercial PCR DIG-labeling mix (Roche)according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The probes for the upstream regions of the pks1 (oligonucleotides 9 and 10) and ku80 (oligonucleotides 24 and 25) deletion constructs were synthetised using PCR DIG DNA Labeling Mix (Roche) and Taq DNA Polymerase (NEB) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... qPCR was performed using 2x qPCRBIO SyGreen Blue Mix Separate-ROX (PCR Biosystems #PB20.17) on a LightCycler® 96 Instrument (Roche). cDNA samples from 21°C rearing with 2 hour heat shock samples were serially diluted to generate standard curves for each amplified gene fragment and to test primer performance (Figure S2A-B) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Real-time reverse transcription PCR assays were conducted in 96-well plates using the LightCycler 480 Instrument (Roche, Wilmington, MA). Levels of mRNA expression were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ...
-
bioRxiv - Plant Biology 2022Quote: ... The abundance of specific transcript was measured by probing 1 μL cDNA by quantitative real-time PCR in a total volume of 10 μl containg 5 μL SYBR-green master mix (Roche), 0.5 μM forward and reverse primer and water ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was diluted to 2 ng/µL and 4 µL were added to 10 µL 2x FastStart Universal SYBR Green PCR Master (Roche). Each sample was run in triplicate using iTaq Universal SYBR Green Supermix (BioRad ...
-
bioRxiv - Neuroscience 2022Quote: ... The coding sequence of full-length hnRNP R was then PCR-amplified from the cDNA using the KAPA HiFi HotStart ReadyMix (Roche) and sub-cloned into pJET1.2 using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The loci of interest were first amplified with 15 cycles of PCR from 2 μL (∼100 ng) of genomic DNA eluate using a 5 μL Kapa HiFi HotStart polymerase reaction (Roche). The first PCR was then diluted with 25 μL of DNAse-free water ...
-
bioRxiv - Molecular Biology 2022Quote: ... Indexes and Illumina cluster generation sequences were then added with a secondary PCR reaction using 3 μL of the diluted primary PCR product with a 10 μL Kapa Robust HotStart polymerase reaction (Roche) for 20 cycles ...
-
Autocrine Sfrp1 inhibits lung fibroblast invasion during transition to injury induced myofibroblastsbioRxiv - Cell Biology 2022Quote: ... qRT-PCR reactions were performed in triplicates with SYBR Green I Master in a LightCycler® 480II (Roche (Risch, Switzerland)) with standard conditions ...
-
bioRxiv - Physiology 2024Quote: ... Gene expression was measured by quantitative reverse transcription PCR (qPCR) using LightCycler 480 SYBR Green I Master (50-720-3180 Roche). Quantitative polymerase chain reaction (PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... The quantitative real-time PCR was done using Maxima SYBR Green/ROX qPCR Master Mix (2X) (Fermentas) and LightCycler 480 (Roche) quantitative PCR machine ...
-
bioRxiv - Neuroscience 2024Quote: The LM-PCR products were then hybridized to the KAPA Target Enrichment Probes following the KAPA HyperCap Workflow v3.0 (Roche Diagnostics). To adjust this protocol for our cloning purposes ...
-
bioRxiv - Systems Biology 2024Quote: ... 15uL of the first round products were mixed into a second PCR reaction that contained 1x KAPA HiFi GC Buffer (Roche), 300uM dNTPs ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic PCR for ATP13A2 floxed or KO alleles was performed using 100 ng genomic DNA and the Kapa2g Fast HotStart PCR Kit (Roche). PCR primers included a forward primer (5’-CTGCAGCTTCGAGAGGAAAG-3’) ...
-
bioRxiv - Pathology 2024Quote: ... cDNA product was 1 to 40 diluted and real-time PCR was performed using FastStart SYBR Green Master Mix (Roche) on QuantStudio 5 (ThermoFisher ...