Labshake search
Citations for Roche :
3701 - 3750 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA was diluted 3-fold with nuclease-free water and 1.5 µL was PCR-amplified using 0.15 U KAPA HiFi HotStart DNA Polymerase (Kapa Biosystems, Wilmington, MA, USA) in a final volume of 10 µL ...
-
bioRxiv - Zoology 2019Quote: ... Polymerase Chain Reaction (PCR) amplification was conducted in 12.5 μl reaction volumes consisting of AmpliTaq® DNA polymerase (Roche Molecular Systems, Inc) forward and reverse primers (0.5 μM each) ...
-
bioRxiv - Microbiology 2019Quote: The pooled library was prepared with 10 μl of barcoded PCR bead purified product from each individual sample and measured with KAPA qPCR library quantification kit (KAPA Biosystems, USA), before being run on an Illumina Mi-Seq Sequencer using a 600-cycle pair end reagent kit (Mi-Seq Reagent Kits v2 ...
-
bioRxiv - Developmental Biology 2019Quote: Non-radioactive RNA in situ hybridization was performed using a digoxigenin (DIG) RNA labeling kit and PCR DIG probe synthesis kit (Roche; http://www.rochediagnostics.us) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction was performed in 96-well plates with a final volume of 20 μl.The thermal melting curve were monitored using a LightCycler 480 II Real-Time PCR System (Roche Diagnostics, Rotkreuz, Switzerland) with a ramp rate of 1 °C at the temperature range from 25 °C to 80 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Libraries were subsequently dual indexed and amplified for 15 cycles using a KAPA HiFi HotStart PCR kit (Kapa Biosystems, Wilmington, Ma. USA) in 50-µl reactions following the manufacturer’s guidelines ...
-
bioRxiv - Developmental Biology 2019Quote: ... tail clips or seminiferous tubules were digested and PCR was performed using KAPA HotStart Mouse Genotyping Kit (KAPA BIOSYSTEMS, Cat No. KK7352). The following primer pairs were used for determining genotype-Sirt1 genotyping ...
-
bioRxiv - Immunology 2019Quote: ... Small fragments of DNA covering the putative cleavage sites were amplified by PCR with KAPA Hifi HotStart Ready Mix (KAPA Biosystems, KK2602) from the genomic DNA using primers p13 and p14 ...
-
bioRxiv - Genetics 2019Quote: ... qRT-PCR was carried out in triplicate with the LightCycler® 480 SYBR Green I Master Kit (Roche Applied Science, Penzberg, Germany) in a 15 μ L reaction on a ABI7500 (Applied Biosystems Inc. ...
-
bioRxiv - Molecular Biology 2019Quote: ... The immunoprecipitated chromatin was purified by phenol-chloroform extraction and quantitative PCR was performed using Rotor-Gene 3000 cycler (Corbett) or LightCycler 480 II (Roche, Mannheim, Germany). Values were expressed relative to the signal obtained for the immunoprecipitation with control IgG ...
-
bioRxiv - Systems Biology 2021Quote: ... Real-time PCR analysis was performed using the LightCycler 480 SYBR Green I Master MIX and LightCycler 96 instrument from Roche (Basel, Switzerland), according to the manufacturer’s protocol with a final individual primer concentration of 0.5 μM ...
-
bioRxiv - Neuroscience 2020Quote: Expression of UPR marker and CDNF mRNAs was quantified using the LightCycler® 480 Real-Time PCR System and Lightcycler 480 SYBR Green I master mix (Roche, Switzerland). β-actin was chosen as a reference gene ...
-
bioRxiv - Cell Biology 2021Quote: ... of these dilutions were used to prepare the reaction mixes for the real-time qRT-PCR using the KAPA SYBR FAST One-Step Universal kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: Total genomic DNA was extracted from myoblasts from all participating patients using a High Pure PCR Template Preparation Kit (Roche, Basel, Switzerland).
-
bioRxiv - Immunology 2020Quote: ... generation of TCR libraries and generation of amplicons for deep sequencing were performed using the KAPA HiFi PCR kit with GC buffer (Roche Diagnostics, #07958846001) and custom designed primers (Supplementary Table 6) ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was carried out on an QuantStudio™ 6 Flex Real-Time PCR System using a SYBR green-based real-time kit (Kapa Biosystems). The RNA polymerase II subunit ama-1 was used as the house-keeping control ...
-
bioRxiv - Cell Biology 2022Quote: ... Barcoded Illumina adaptor sequences (Table S2) were added to the tagmented DNA by PCR (KAPA HiFi HotStart ReadyMix, Kapa Biosystems, 20 cycles). And the DNA was cleaned with a x0.9 SPRI procedure ...
-
bioRxiv - Cell Biology 2022Quote: Long-range PCR was performed with the Kapa Long Range DNA polymerase according to the manufacturer’s recommendations (Kapa Biosystems, Boston, MA, USA), with 0.5µM of each primer and 20ng of DNA ...
-
bioRxiv - Microbiology 2021Quote: ... The purified indexed PCR library products were quantified using the KAPA Library Quantification Kit from Roche (cat. no. 07960255001, kit code KK4844), normalized to a concentration of 7 nM ...
-
bioRxiv - Microbiology 2020Quote: ... Each mosquito DNA extract was run in triplicate alongside standard curves and NTCs and PCR results were analysed using the LightCycler® 96 software (Roche Diagnostics). Multilocus strain typing (MLST ...
-
bioRxiv - Microbiology 2020Quote: Quantification of precipitated DNA was determined using real-time quantitative PCR (qPCR) with SYBER Green in FastStart Essential DNA Green Master (Roche, Basel, Switzerland). Each resultant DNA was diluted in nuclease-free water and was analyzed in triplicated for EBV-associated genes and CTCF binding sites ...
-
bioRxiv - Immunology 2020Quote: ... ATAC-Seq libraries were then purified using a QIAGEN PCR cleanup kit and quantified using KAPA library quantification kit (KAPA Biosystems, Roche) and sequenced on the Nextseq 550 platform.
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative PCR was performed using the 5x HOT FIREPol® EvaGreen® qPCR Supermix (Solis Biodyne) and the LightCycler 480 II instrument (Roche). For RT-qPCR ...
-
bioRxiv - Epidemiology 2020Quote: ... plasmids or DNA samples (Table 1) by real-time TaqMan PCRs assays on a LightCycler® 480 (LC480) (Roche Applied Science, Germany). Real-time PCR assays were performed with LightCycler® 480 Probe Master Mix 1× (Roche Applied Science ...
-
bioRxiv - Cell Biology 2019Quote: Each first strand cDNA reaction was supplied with 15 µl of PCR mix containing 1x KAPA HiFi HotStart Ready Mix (Kapa Biosystems, KK2601), 1 µM IS PCR primer (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl of immunoprecipitated RNA was used for quantification of mRNA expression levels by RT-qPCR as described in the section ‘Quantitative PCR’ except that DNase treatment was omitted and 1 μg yeast RNA (Roche, Basel, Switzerland) was added in the cDNA reaction.
-
bioRxiv - Neuroscience 2020Quote: ... Real-time semiquantitative PCR with TaqMan and SYBRGreen were performed in the LightCycler 480 Systems (384-well format, Roche Applied Science, Germany) with a reaction mix prepared to the final volume of 10 µL ...
-
bioRxiv - Pathology 2020Quote: ... The specific pairs of primers used for the real-time PCR are listed in Supplementary Table 4 (designed by Universal ProbeLibrary Assay Design Center tool from Roche, Indianapolis, IN). The real-time PCR was performed with FastStart Universal Probe Master mix ...
-
bioRxiv - Cancer Biology 2019Quote: ... The cDNAs were subsequently used for qRT-PCR reactions using KAPA SYBR FAST Universal 2X qPCR Master Mix (KAPA BIOSYSTEMS, Wilmington, MA) and the primers indicated in Supplementary Table 2 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... SYBR Premix Ex Taq (Tli RNaseH Plus) was used for qRT-PCR on a LightCycler 480 II thermal cycler system (Roche, Mannheim, Germany). 16S rRNA gene was selected as internal standard.
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative reverse transcription (qRT)-polymerase chain reaction (PCR) analysis of cDNA expressions was conducted using SYBR FAST Universal qPCR Master Mix (Kapa Biosystems; #KK4602) with a StepOnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The libraries were quality controlled on an Agilent 2100 Bioanalyzer with the DNA 7500 assay for size and the concentration was estimated using quantitative PCR with the KAPA Library Quantification Kit Illumina® Platforms (Roche Kapa Biosystems). To obtain sufficient amount of libraries for sequencing it was necessary for the low input libraries (0,1 - 0,2 ug ...
-
bioRxiv - Microbiology 2020Quote: ... and prepared for shotgun metagenomic sequencing using the Kapa Hyperprep Plus kit with 3 rounds of PCR amplification (Kapa Biosystems, Wilmington, MA), and sequenced to an average depth of 7 gbp per fraction on the Illumina NovaSeq (Illumina ...
-
bioRxiv - Microbiology 2020Quote: Each 300 μL of GEA supernatant sample was extracted using the High Pure PCR Template Preparation Kit (Roche Life Science, Mannheim, Germany), a kit based on silica-membrane spin columns technology ...
-
bioRxiv - Microbiology 2021Quote: ... A single sample (one mouse) was assessed on each array plate on a Roche Light Cycler 480 II real time PCR thermal cycler (Roche, Basel, Switzerland). All data were analyzed with Qiagen’s Gene Globe online analysis application ...
-
bioRxiv - Immunology 2020Quote: ... pursued by 95°C for 3 minutes and then 45 cycles at 95°C for 15 seconds and 58°C for 30 seconds using a LightCycler 480 Real-Time PCR system (Roche, Rotkreuz, Switzerland). The primers and the probes were designed against the E gene (20).
-
bioRxiv - Immunology 2020Quote: ... and a quantitative Real-Time PCR was performed according to the manufacturer’s instructions (MMLV Kit, Life Technologies and Smart SYBRGreen kit, Roche Applied Science). Circadian gene expression was investigated using specific primers targeting Bmal1 and Clock genes (8) ...
-
bioRxiv - Immunology 2021Quote: ... ATAC-Seq libraries were then purified using a QIAGEN PCR cleanup kit and quantified using KAPA library quantification kit (KAPA Biosystems, Roche) and sequenced on the Nextseq 550 platform.
-
bioRxiv - Genetics 2022Quote: ... to evaluate library size and adapter dimer presence before the library concentration was determined via quantitative real time PCR using the KAPA library quantification kits (KK4824, Roche, Basel, Switzerland) on the QuantStudio7 or ViiA7 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using the HOT FIREPol® EvaGreen® qPCR Supermix (Solis BioDyne) and the LightCycler 480 II instrument (Roche). For RT-qPCR ...
-
bioRxiv - Cell Biology 2022Quote: ... The mRNA abundance for the genes (Supplementary Table 1) of interest was determined by quantitative PCR using Fast Start SYBR Green (Roche, Cat# 4673484001). The data was quantified by the comparative ΔCT method and expressed relative to β-actin mRNA.
-
bioRxiv - Cell Biology 2022Quote: ... The enrichment of specific target DNA sequences and controls in the immunoprecipitated material vs the input was determined by quantitative PCR (qPCR) using the HOT FIREPol® EvaGreen® qPCR Supermix (Solis BioDyne) and the LightCycler 480 II instrument (Roche). The primers used are listed in Table S2.
-
bioRxiv - Genomics 2022Quote: ... The amplification of 16S rRNA genes was conducted using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, Wilmington, MA, USA) in a total volume of 25□μl ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed using UBC and EEF as reference genes on a Roche Lightcycler 480 device (Roche Molecular Systems Inc.) with SYBR Green I Master kit (Roche) ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was performed on cDNAs in a final volume of 10 µL using SYBR Green I master mix (Roche Life Science) and primers for AtCLCa gene ...
-
bioRxiv - Neuroscience 2022Quote: ... probe-specific realtime quantitative PCR (qPCR) was performed using LightCycler® Multiplex DNA Master (Roche07339585001) on a LightCycler® 96 system (Roche) following Jax Genotyping Protocol #22109 ...
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR reactions were carried out in triplicates following a 3-step amplification protocol using the LightCycler 480 system (Roche Diagnostics, Switzerland). The ΔΔCT method [94] was used to calculate gene expression changes relative to housekeeping genes β-actin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The beads were magnetically separated as above and pooled eluate added to PCR strip tubes containing 2X KAPA HiFi HotStart ReadyMix (Roche, Cat# 07958935001) and 2 mM each of P5 (AATGATACGGCGACCACCGAGATCTACA*C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We incorporated sample-specific dual-indexed adapters to library fragments (Glenn et al., 2019) by PCR amplifying the resulting libraries using HiFi Hotstart ReadyMix (Kapa Biosystems, Inc.) and 8-12 PCR cycles following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Abutting primer pairs were designed that were specific to these genetic groups (Supplementary Table 3) to enable the recovery of full viral genomes using polymerase chain reaction (PCR) with HiFi HotStart DNA polymerase (Kapa Biosystems, USA) using cycling conditions per the manufacturer’s instructions ...