Labshake search
Citations for Roche :
3601 - 3650 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Zoology 2019Quote: ... 1 μg of total RNA was first retrotranscribed with primers supplied in the kit and this first-strand cDNA was used directly in PCR amplification reactions that were achieved using a high-fidelity enzyme (KAPA HiFi DNA Polymerase, Kapa Biosystems), the Universal Primer Short (UPS ...
-
bioRxiv - Molecular Biology 2019Quote: Re-amplification of primary WTA products was performed in a reaction volume of 50 μl comprising 5 μl Expand Long Template Buffer 1 (Expand Long Template PCR System, Roche Diagnostics), 6 μl of CP2-15C or CP2-9C primer (2.88 μM ...
-
bioRxiv - Molecular Biology 2019Quote: ... primary or re-amplified WTA products) added to 1 μl Expand Long Template Buffer 2 (Expand Long Template PCR System, Roche Diagnostics), 1 μl dNTPs (10 mM each) ...
-
bioRxiv - Genomics 2019Quote: ... The barcode sequencing libraries were subjected to a final bead clean-up SPRIselect reagent and quantified by quantitative PCR (KAPA Biosystems Library Quantification Kit for Illumina platforms ...
-
bioRxiv - Microbiology 2019Quote: ... The probe was amplified by PCR with digoxigenin-dUTP from the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche Diagnostics), using the glms sequence as a template ...
-
bioRxiv - Microbiology 2019Quote: ... Each reaction contained a 5μl of a 1 in 10 dilution of genomic DNA and was carried out in quadruplicate in a volume of 15 μl in a 384-well LightCycler® 480 PCR plates (Roche), sealed with LightCycler® 480 sealing foil (Roche) ...
-
bioRxiv - Developmental Biology 2020Quote: A 257 bp digoxigenin-labeled RNA probe was generated from a region spanning exons 1-3 of cat Dkk4 using a PCR-based template (cDNA from Stage 16 cat embryonic epidermal cells; CCCTGAGTGTTCTGGTTTT, AATATTGGGGTTGCATCTTCC) and in vitro transcription (Roche Diagnostics). 10 μ M paraffin-embedded sections were deparaffinized with xylenes and antigen retrieval using 0.01 M citrate buffer ...
-
bioRxiv - Genomics 2019Quote: All 192 bp enhancers were amplified from the array using HSSF-ATGC and HSS-R-clon (Supplemental Table 8) with KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (Kapa Biosystems) with SYBR Green (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcription products were then amplified by quantitative PCR (95 °C, 5 minutes; 95 °C, 15 seconds; 60 °C, 60 seconds; 40 cycles) (LightCycler® 480, Roche) using TaqMan Universal PCR Master Mix and specific probes for miRNAs ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl of each unpurified amplicon was then carried to a second PCR reaction using KAPA HiFi Library Amp (Roche Sequencing). NEBNext Multiplex Oligos (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: PCR amplification of RNA editing containing sequence were performed by using cDNA and gDNA as templates with KAPA HiFi HotStart ReadyMix PCR kit (Roche, Germany) and the following program ...
-
bioRxiv - Microbiology 2021Quote: ... were used for the purification steps and the libraries were amplified (9 amplification cycles) with the KAPA HiFi PCR Kit (Kapa Biosystems) in KAPA HiFi Fidelity Buffer (5x) ...
-
bioRxiv - Genetics 2020Quote: Genomic DNA was isolated from well-developed leaves of 14-day plants according to the modified CTAB procedure (Murray and Thompson, 1980) or by using the KAPA3G Plant PCR Kit (Kapa Biosystems). The PCR for genomic DNA isolated by CTAB was carried out in a 25 ml reaction mixture using Platinum Taq DNA Polymerase (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... and UCRS Fwd and SF Rev respectively (Table S1) in PCR reactions with either KAPA HiFi DNA polymerase with high GC buffers (KAPA Biosystems) or Hot FIREPol Blend Master mix (Solis BioDyne) ...
-
bioRxiv - Genomics 2019Quote: ... a total of 12 µg of DNA was split into 24 50 µL PCR reactions (each with 500 ng of input DNA) with KAPA2G Robust HostStart ReadyMix (Kapa Biosystems) for three cycles with a 65 °C annealing and 40 s extension ...
-
bioRxiv - Immunology 2020Quote: ... Real-time PCR was performed in a final reaction volume of 20 µL containing 10 µL FastStart universal probe master (Roche Diagnostics), 50 ng/µL lambda DNA (New England Biolabs) ...
-
bioRxiv - Genomics 2021Quote: ... Sequencing adapters were added in a second PCR using three reactions with 10 μl of the purified junction PCR product with the KAPA HotStart HiFi Ready Mix (KAPA Biosystems) for 12 cycles ...
-
bioRxiv - Genomics 2021Quote: ... an aliquot of 6,000 beads was amplified by PCR in a volume of 50 μL (25 μL of 2x KAPA HiFi hotstart readymix (KAPA biosystems), 0.4 μL of 100 mM TSO-PCR primer (AAGCAGTGGTATCAACGCAGAGT (Macosko et al. ...
-
bioRxiv - Genomics 2021Quote: ... Strand-specific Illumina cDNA libraries were prepared using the KAPA Stranded RNA-Seq library preparation kit with 10 cycles of PCR (KAPA Biosystems). Library quality was assessed by BioAnalyzer (Agilent ...
-
bioRxiv - Plant Biology 2021Quote: ... and the mRNA content was quantified by real-time PCR using the LightCycler® 96 System (Roche Diagnostics K.K., Tokyo, Japan) with a KAPA SYBR FAST One-Step qRT-PCR Kit (Nippon Genetics Co. ...
-
bioRxiv - Developmental Biology 2019Quote: CISH riboprobes were generated from the gDNA or cDNA with PCR and labeled with digoxigenin (DIG) using DIG RNA labeling mix (Roche, 11277073910) by in vitro transcription ...
-
bioRxiv - Physiology 2019Quote: The expression pattern of Mr-GS in various tissues at different time points was studied using qRT-PCR in Roche LightCycler 480 (Roche, USA). All used primers were presented in Table 1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and an equimolecular pool of libraries was prepared and titrated by qRT-PCR using the “Kapa-SYBR FAST qPCR kit forLightCycler480” (Kapa BioSystems, Fritz Hoffmann-La Roche ...
-
bioRxiv - Microbiology 2019Quote: ... All q-PCRs were performed in Rotor-Gene 6000 (Corbett Life Science) and using FastStart Essential DNA Green Master Kit (Roche, Switzerland). The total volume for qPCR was 10 μl ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were assessed using Bioanalyzer DNA High Sensitivity chips and quantified by quantitative PCR using Kapa Library Quantification Illumina/ABI Prism Kit protocol (KAPA Biosystems). Validated libraries were pooled in equimolar quantities and paired-end sequenced on an Illumina HiSeq X platform following Illumina’s recommended protocol to generate paired-end reads of 150 bases in length.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina compatible adapters (IDT, Inc) were ligated to the mate pair fragments and amplified with 8-12 cycles of PCR (KAPA Biosystems).
-
bioRxiv - Physiology 2021Quote: ... The expression of targeted genes and GAPDH transcripts were monitored by LightCycler®480 Real-time PCR (Roche Diagnostics GmbH, Germany) using gene-specific primers (Eurofins ...
-
bioRxiv - Molecular Biology 2020Quote: ... a partial CYP6P9a upstream region was amplified in a final volume of 15μl PCR mixture contained 1.5μl of 10X Kapa Taq buffer A (Kapa Biosystems, Wilmington, MA, USA), 0.12μl of 5 U/μl KAPA taq ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified using primers Sb.1 - Sb.2 and Sb.3 to Sb.8 (Table 2) and labeled with digoxigenin (DIG) using the PCR DIG probe synthesis kit (Roche Diagnostics). Membranes were hybridized with these probes at 65°C and then washed at 68°C with decreasing concentrations (from 2X to 0.2X ...
-
bioRxiv - Biochemistry 2021Quote: ... the amino acid Thr at position 206 was mutated to Trp using KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems, USA) together with the designed complementary primers (5’- CCTATCTGATTCATGAGCACATGGTTATTTGGGATCGCATTGAAAAC-3’ and 5’- GTTTTCAATGCGATCCCAAATAACCATGTGCTCATGAATCAGATAGG-3’ ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were then quantified through real-time PCR with the KAPA Library Quant Kit for Illumina (KAPA Biosystems catalog no. KK4835). Finally ...
-
bioRxiv - Genomics 2020Quote: ... The six STARR-Seq RNA replicate libraries and a STARR-Seq Plasmid DNA input library (amplified as before but with 20 ng DNA input and 15 PCR cycles) were normalized with the KAPA Library Kit (KAPA Biosystems) and sequenced on an Illumina NextSeq with 150-bp paired-end reads using standard protocols.
-
bioRxiv - Plant Biology 2021Quote: ... and NADP-ME3 (Zm00004b015828) were quantified via qRT-PCR using a Roche Light Cycler 480 II using Roche SYBR green I (Roche 04707516001). The delta cT method was used to quantify relative gene expression of PEPCK1 and NADP-ME3 over time ...
-
bioRxiv - Immunology 2021Quote: ... The transcripts for genes of interest were measured by real-time PCR with a Lightcycler 480 II system (Roche, Basel, Switzerland) and a Brilliant III SYBR Green Master mix (Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... on an Agilent Bravo WS automation system followed by 14 cycles of PCR using KAPA HiFI Hot Start polymerase (KAPA Biosystems). The libraries were then pooled in equimolar amounts and 75bp paired-end reads were generated on the Illumina HiSeq 4000 according to the manufacturers standard sequencing protocol.
-
bioRxiv - Immunology 2021Quote: ... ATAC-Seq libraries were then purified using a QIAGEN PCR cleanup kit and quantified using KAPA library quantification kit (KAPA Biosystems, Roche) and sequenced on the Nextseq 550 platform.
-
bioRxiv - Developmental Biology 2020Quote: ... In vitro transcription was performed on the pcr product with Ampliscribe T7-flash kit with Dig RNA labeling mix from Roche(75). In situ hybridization with both the anti-sense probes yielded the same results.
-
bioRxiv - Cell Biology 2021Quote: ... Eluted DNA was quantified by real-time PCR on a Roche LightCycler by using FastStart Universal SYBR Green Master (Roche, #4913850001) with the set of primers listed in Supplementary Table 4 ...
-
bioRxiv - Molecular Biology 2022Quote: CISH riboprobes for Spp1 and Myh9 were generated from gDNA or cDNA with PCR and labeled with digoxigenin (DIG) using DIG RNA labeling mix (Roche, 11277073910) by in vitro transcription ...
-
bioRxiv - Biochemistry 2022Quote: Plasmids were constructed using standard molecular biology techniques of PCR and Golden Gate assembly with Kapa HiFi DNA Polymerase (KAPA Biosystems), restriction enzymes (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time PCR was carried out with the Light Cycler Fast Start DNA Master SYBR Green Kit (Roche Applied Science, Germany) using LightCycler (Roche Applied Science ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA from twenty-four females from each of the four groups was extracted using Roche High Pure™ PCR Template Preparation Kits (Roche Molecular Systems ...
-
bioRxiv - Microbiology 2022Quote: ... The total HIV-1 DNA was amplified by quantitative real-time PCR using the Light Cycler instrument (Roche Diagnostics, Meylan, France). Amplification was performed in a 20 μl reaction mixture containing 1× Light Cycler Fast Start DNA master hybridization probes (Roche Diagnostics) ...
-
bioRxiv - Plant Biology 2022Quote: Real-time PCR was performed using the HS-qPCR SYBR Blue (2x) (Biolabmix, Russia) on a LightCycler®96 (Roche, Germany). qPCR was carried out in three biological and three technical replicates ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative real-time polymerase chain reaction (qRT-PCR) was performed with the KAPA SYBR Fast qPCR kit (KAPA Biosystems Cat# KK4608) on a CFX96 Real-Time PCR Detection System (Bio-Rad RRID ...
-
bioRxiv - Cell Biology 2022Quote: ... The lyophilized oligo pool was resuspended in Tris-HCl (pH 8) and PCR-amplified using KAPA HiFi HotStart DNA Polymerase (Roche, KK2502) with 52 °C anneal and 15 sec extension (10 cycles) ...
-
bioRxiv - Neuroscience 2024Quote: ... titer was determined at a concentration of 1.1013 gcp/ml by quantitative real-time PCR using the Light Cycler 480 SYBR green master mix (Roche, cat # 04887352001) with primers specific for the AAV2 ITRs (fwd 50-GGAACCCCTAGTGATG GAGTT-3’ ...
-
bioRxiv - Genetics 2024Quote: ... an aliquot of 6,000 beads was amplified by PCR in a volume of 50 μL (25 μL of 2x KAPA HiFi hotstart readymix (KAPA biosystems), 0.4 μL of 100 mM TSO-PCR primer (AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Physiology 2024Quote: ... Real-time PCR was performed by using ChamQ Universal SYBR qPCR Master Mix (Q711-02, Vazyme) on the Roche LightCycler96 (Roche, 05815916001) system ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...