Labshake search
Citations for Roche :
3251 - 3300 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Long-range PCR was performed with the Kapa Long Range DNA polymerase according to the manufacturer’s recommendations (Kapa Biosystems, Boston ...
-
bioRxiv - Developmental Biology 2022Quote: ... The library was enriched using 14 PCR cycles and quantified with Kapa NGS library quantification kit (Kapa Biosystems, KK4824) before pooling at a concentration of 20nM ...
-
bioRxiv - Cancer Biology 2022Quote: ... Post-capture amplification was performed using the KAPA HiFi Hot Start PCR ReadyMix Kit (KAPA Biosystems, Catalogue no. KK2601). Post-capture amplified libraries were quality controlled and quantified using a Tapestation 2200 with the High Sensitivity reagents.
-
bioRxiv - Microbiology 2022Quote: ... the semi-nested real-time q-PCR reactions (LightCycler 480 II, Roche Life Science, Roche Diagnostics Corporation, IN, USA) were performed with 1:5-diluted 1st PCR product ...
-
bioRxiv - Neuroscience 2022Quote: ... Realtime PCR was performed by using SYBR Green dye detection according to the manufacturer’s instruction (SYBR Green PCR Master Mix, Roche) on a LightCycler480 system ...
-
bioRxiv - Bioengineering 2022Quote: ... and quantitative PCR was performed on a Roche LightCycler 96 using the FastStart Essential DNA Green Master mix (Roche) with the following condition ...
-
bioRxiv - Plant Biology 2021Quote: ... The final products were purified and enriched via 10 cycles of PCR using KAPA HiFi HotStart ReadyMix (Roche, Switzerland) and primer mix from a Swift Library kit to create the final double-stranded cDNA library ...
-
bioRxiv - Plant Biology 2021Quote: ... The final products were purified and enriched with 10 PCR cycles using the KAPA HiFi HotStart ReadyMix (Roche, Switzerland) and primers mix from the Swift library kit ...
-
bioRxiv - Plant Biology 2021Quote: ... Enriched products were PCR-amplified for 14 cycles using the 2X KAPA HiFi HotStart Mix (KAPA Biosystems, Wilmington, USA) and the P7 and P5 adapters as primers ...
-
bioRxiv - Microbiology 2020Quote: DNA was used as a template for the real-time PCR amplification using a LightCycler Nano instrument (Roche diagnostics), Fast Start Essential DNA Green Master Green (Roche diagnostics ...
-
bioRxiv - Neuroscience 2020Quote: ... CDNA was used as template for PCR reactions with LightCycler® 480 SYBR Green I Master (Roche, Cat. # 04707516001) in a Roche LightCycler® 480 II machine ...
-
bioRxiv - Developmental Biology 2022Quote: ... and PCR products were quantified fluorometrically using the KAPA SYBR FAST qPCR Master Mix (2X) Kit (KR0389, KAPA Biosystems).
-
bioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s protocol and amplification was quantified on an LightCycler 480 II Real-Time PCR System (Roche). In all cases ...
-
bioRxiv - Genomics 2022Quote: ... 100 ng cDNA from each sample was subjected to quantitative real-time PCR (qPCR) following the manufacturer’s instructions of PerfectStart Green qPCR SuperMix (TransGen Biotech, #1) on LightCycle480 Instrument II (Roche). Relative mRNA expression was normalised to RPLP0 using standard statistics method of 2-ΔΔCT.
-
bioRxiv - Genetics 2022Quote: ... Total Ty1-copia sequences labeled with DIG were prepared as probes using the PCR-DIG Probe Synthesis Kit (Roche). ImageJ and Calculator software (http://cels.uri.edu/gsc/cndna.html ...
-
bioRxiv - Cell Biology 2022Quote: ... diluted 10 times and 1 μl was used in 5-μl PCR reaction on a LightCycler 480 (Roche Diagnostics) with Luna Master Mix (New England Biolabs ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantified Real-time PCR (qPCR) analyses were carried out using the FastStart Essential DNA Green Master (Roche, Swiss Confederation) as instructed by the manufacturer ...
-
bioRxiv - Cell Biology 2022Quote: ... The level of miRNAs was analyzed by qRT-PCR on Roche Lightcycler 96 Detection System (Roche, Auckland, New Zealand) using a stem-loop RT probe (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2019Quote: Digoxigenin (DIG)-labelled probes for in situ hybridization was synthesized by PCR using DIG RNA labelling kit (Roche #11175025910). The probes for Ssadh and CG33791 (αKDH ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... a 183-nucleotide long single-stranded DNA probe containing digoxygenin dNTP was prepared via asymmetric PCR (Roche Molecular Biochemicals) and the following primers ...
-
bioRxiv - Genomics 2020Quote: ... Library fragments were then subjected to 7 cycles of PCR amplification with KAPA HiFi Uracil+ DNA polymerase (KAPA Biosystems). Single-end 100 bp sequencing was performed on a HiSeq 1500 or a MiSeq (Illumina).
-
bioRxiv - Physiology 2019Quote: ... real-time monitoring of PCR amplification of cDNA with FastStart Universal SYBR Green Master (Roche Applied Science, Indianapolis, IN) in an ABI Prism 7900 Sequence Detection System (Life Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR reaction was prepared using a LightCycler® 480 SYBR Green I Master kit (Roche Diagnostics, Mannheim, Germany) and the PCR was performed with a LightCycler® 480 Instrument II (384-well ...
-
bioRxiv - Cell Biology 2019Quote: ... The barcoded sequencing libraries were quantified by quantitative PCR using the KAPA Library Quantification Kit (KAPA Biosystems, Wilmington, MA). Sequencing libraries were sequenced using Novaseq 6000 (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... Cells were then harvested and genomic DNA was extracted with a High Pure PCR Template Preparation Kit (Roche 11796828001). MinION runs were performed on R9 with 400-500ng purified DNA per sample following library preparation with Ligation Sequencing Kit 1D (ONT SQK-LSK108) ...
-
bioRxiv - Genomics 2020Quote: ... Bisulfite converted DNA was then used as template for PCR amplification with KAPA HiFi HotStart Uracil kit (Roche, KK2801) using primers surrounding Site 1 in intron 8 of the Fto gene ...
-
bioRxiv - Genomics 2019Quote: All 5’ fragments were amplified off the array using HSSF-ATGC and DO_15R_PU (Supplemental Table 8) with KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (Kapa Biosystems) and stopped before plateauing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time monitoring of PCR amplification of cDNA was carried out using FastStart Universal SYBR Green Master (Rox, Roche). The primers used for gene expression are ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR reaction mixture (25 μl total volume) comprised of 10 μl of 2X KAPAHiFi HotStart Mix (Roche, Switzerland), 5 μM each of 341f and 805r primers and 5 μl of DNA template which was ≥20Lng/μl ...
-
bioRxiv - Molecular Biology 2021Quote: Telomere lengths from obtained DNA samples were determined in a quantitative real-time Light Cycler 480 PCR (Roche, Germany) device using appropriate primers (Tel F:CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGT and Tel R:GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT ...
-
bioRxiv - Genetics 2020Quote: ... 721-bp tandem and 1600-bp tandem repeats were selected and PCR labelled with tetramethyl-rhodamin-5-dUTP (Roche) (Ishii et al ...
-
bioRxiv - Plant Biology 2020Quote: The qRT-PCR analysis was performed with LightCycler 480 instrument and software v1.5.0.39 (Roche Applied Sciences, Foster, CA, USA). The transcript abundance was detected by using LightCycler® SYBR Green I Master qPCR kit (Roche) ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative PCR reactions were performed in a total volume of 10 μL of SYBR Green master mix I (Roche) in 384-wells plates on a Lightcycler LC480 apparatus (Roche ...
-
bioRxiv - Physiology 2019Quote: ... The qRT-PCR reactions were carried out in triplicate in 96-well plates and each PCR sample consisted of 6μl 2X SYBR green master mix buffer (Roche), 0.024μl of forward and reverse primers 25nmole and 3.953μl of RNase-free water ...
-
bioRxiv - Genomics 2020Quote: ... The fragmented DNA was then ligated with dual-indices using a KAPA Hyper prep PCR-free library kit (Roche) according to the manufacturer’s directions ...
-
bioRxiv - Biochemistry 2020Quote: ... The constitutive promoter-RBS combination apFAB61-BBa_J61132 and the TtgR gene were amplified via KAPA HiFi PCR mix (Roche) using primers with homology to the pSC101 backbone41 ...
-
bioRxiv - Biochemistry 2021Quote: ... A small fraction of the cDNA and input were allocated to real-time PCR quantification using a LightCycler 2.0 (Roche); the remainder was amplified by PCR ...
-
bioRxiv - Cell Biology 2020Quote: ... The barcoded sequencing libraries were quantified by quantitative PCR using the KAPA Library Quantification Kit (KAPA Biosystems, Wilmington, MA). Sequencing libraries were loaded on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... KAPA PCR mix (2.775 X HiFi Buffer, 0.85 mM dNTPs, 0.05 U KAPA HiFi polymerase / µL, Roche Cat# 07958846001). The chip was sealed for heated incubation and spun down at 1200 x g for 1 min after each dispense ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time quantitative PCR (qPCR) reactions were performed in duplicate with the FS Universal SYBR Green Master (4913914001, Roche) and run on the iCycler MyiQ2 Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Amount of the different mRNAs were determined by quantitative real-time PCR using the Universal ProbeLibrary (Roche, Life Science) and LightCycler 480 Probes Master (Roche ...
-
bioRxiv - Immunology 2021Quote: ... The PCR products were used to synthesize dsRNA using a T7 RNA Polymerase Kit (Sigma-Aldrich RPOLT7-RO ROCHE). Generated dsRNAs were treated with TURBO DNA-free Kit (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted from BHI broth cultures using the High Pure PCR template preparation kit (Roche, Potsdam, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... The first PCR was performed in 10 μl and consisted of 1x KAPA HiFi Hot Start Ready Mix (Roche), each 16S rRNA primer at 0.2 μM and 3-μl DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Genetics 2020Quote: ... The DNA concentration of the library was determined using the LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland) with KAPA Library Quantification Kit (KAPA Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Three parallel measurements were performed with each sample in a LightCycler® 96 real-time PCR instrument (Roche, Switzerland). Relative transcription levels (ΔΔCP value ...
-
bioRxiv - Molecular Biology 2021Quote: ... Captured libraries were re-amplified using Post LM-PCR oligos (Nimblegen) and KAPA High-Fidelity DNA polymerase (KAPA Biosystems) directly from the beads ...
-
bioRxiv - Molecular Biology 2022Quote: ... Half of the reverse transcription reaction was used for amplification with a KAP real-time PCR mixture (KAPA Biosystems) using the Illumina Truseq small RNA library amplification kit primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA expression levels were determined by qRT-PCR with KAPA SYBR FAST qPCR Master Mix Kit (Kapa Biosystems, KK4610). cDNA was synthesized from human cells using SuperPrep II Cell Lysis & RT Kit (TOYOBO ...