Labshake search
Citations for Thermo Fisher :
9351 - 9400 of 10000+ citations for 5 NITROFURFURYL ALCOHOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: Neuronal suspensions were labelled at 37°C with a combination of the Fluo-4 calcium indicator (5 μg/ml; Invitrogen) and either Alexa-Fluor 594-coupled Wheat Germ Agglutinin (WGA ...
-
bioRxiv - Immunology 2021Quote: ... Epithelial cells were separated from the lamina propria via a 40-min incubation with gentle agitation in dissociation buffer (HBSS with 15 mM HEPES (Thermofisher, 5 mM EDTA (Invitrogen), 10% FBS (Gibco) ...
-
bioRxiv - Biochemistry 2019Quote: ... were grown to 80% confluence at 37°C with 5% CO2 on 78 cm2 dishes using DMEM high glucose (Dulbecco’s Modified Eagle, glucose 4.5 g/L, Gibco, 41966–029), 10% bovine serum (Gibco ...
-
bioRxiv - Immunology 2019Quote: ... the mice received a tail vein injection containing of either vehicle alone or KKO or DG-KKO or TRA or DG-TRA at doses of 5 mg/kg diluted in 200 μl of phosphate buffered saline (PBS with CaCl2 and MgCl2, Gibco). Five hours after LPS treatment ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was cloned between 5’ KpnI and 3’ EcoRI sites of the pMT/V5-His vector (Invitrogen). In-frame Tag-RFP-T gene was then introduced at the 3’ end of γ-tubulin gene between 5’ EcoRI and 3’ NotI sites ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was then inserted into the 5’ SpeI and 3’ EcoRI sites of the pMT/V5 His-B vector (Invitrogen) containing in-frame mTurquoise2 gene at the 5’ end ...
-
bioRxiv - Cell Biology 2019Quote: ... 5) We then transformed the DNA into ElectroMAX™ DH1OB™ T1 R cells (Life Technologies, prod. number 12033-015) using electroporation and recovered the colonies on LB plates supplemented with 100μg/ml Blasticidin ...
-
bioRxiv - Cell Biology 2019Quote: ... The fluorgenic substrate (5 μM) was mixed with control and test samples in 96 well plates (Black wall plate, Nunc), incubated for 1 h at 37 °C ...
-
bioRxiv - Neuroscience 2019Quote: ... post-axotomy cultures were loaded with lipophilic dye N-(3-trimethylammoniumpropyl) -4-(6-(4-(diethylamino) phenyl) hexatrienyl)pyridinium dibromide (FM 5–95; Invitrogen) using KCl mediated depolarization as described previously (Taylor et al ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were then washed 4 times for 30 minutes in 1x PBS/0.3% Triton X-100/5% NDS and then mounted with Molecular Probes ProLong® Diamond anti-fade mounting medium (Invitrogen). Images where captured on a Zeiss confocal LSM780 with Zen software ...
-
bioRxiv - Microbiology 2019Quote: ... was carried out by taking 500 µl of the culture from respective time points into Eppendorf tubes and incubated them with 5 µM 3’-(p-hydroxyphenyl fluorescein (HPF; Invitrogen) (0.5 µl of HPF from 5 mM stock ...
-
bioRxiv - Microbiology 2019Quote: ... double-stranded cDNA was synthesized from 5 μg of total RNA using the Superscript double-stranded cDNA synthesis kit (Invitrogen). Following phenol/chloroform extraction and ethanol precipitation ...
-
bioRxiv - Developmental Biology 2019Quote: The E11.5 Yolk sacs from miR144/451+/GFP mouse embryos were first collected in 1xPBS+10% Fetal Bovine Serum (10270106, Gibco). Upon dissection they were fixed in 4% Paraformaldehyde solution in PBS (sc-281692 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 μm) and a C18 analytical column (PepMapAcclaim C18, 50 cm x 075 mm, 2 μm, Dionex-Thermo-Fisher Scientific), applying a linear gradient from 2 to 35 % solvent B (80 % acetonitrile ...
-
bioRxiv - Biochemistry 2020Quote: ... De-phosphorylated tsRNA or synthetic RNA (scrambled) were 5’-thiolated by incubation with 0.5 U/µL polynucleotide kinase (ThermoFisher Scientific) in the presence of 0.5 mM ATPγS (SIGMA ...
-
bioRxiv - Developmental Biology 2019Quote: ... and sequenced with the primers indicated in Extended Data Table 5 using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a 3130xl Genetic Analyzer (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2019Quote: ... Porcine jejunum epithelial cell line IPEC-J2 (ACC-701) was grown in DMEM F12 medium supplemented with 10% FBS and 5% penicillin/streptomycin (P/S, Gibco) in 75 cm2 culture flasks ...
-
bioRxiv - Cell Biology 2019Quote: ... Point-spread functions for deconvolution were experimentally measured using 200nm tetraspeck beads adhered to 5 mm glass coverslips (T7280, Invitrogen) for 488 excitation wavelength.
-
bioRxiv - Cell Biology 2019Quote: ... CENP-F-Mut1 and CENP-F-Mut2 cells were grown in a humidified incubator at 37°C and 5% CO2 in DMEM (Gibco) containing 10% FCS (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: ... TCam-2 cells were grown in 37°C and 5% CO2 in Roswell Park Memorial Institute (RPMI, Life Technologies 61870044) 1640 medium supplemented with 10% FBS (GE Healthcare HyClone SH30071 ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Immunology 2019Quote: RAW 264.7 macrophages (ATCC) were cultured at 37°C with a humidified atmosphere of 5% CO2 in DMEM (Thermo Fisher) with 10% FBS (Sigma Aldrich ...
-
bioRxiv - Microbiology 2019Quote: ... A 2 μl volume of cDNA diluted 1:4 (IAV) or 1:5 (reovirus) in molecular biology grade water (Invitrogen) was added to the 384 well plate ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by three washes in PBS (5 minutes) and incubation with Hoechst 33258 and Alexa-labelled secondary antibodies (Thermo Fisher) in blocking buffer for 30 minutes ...
-
bioRxiv - Developmental Biology 2019Quote: ... E8 medium was replaced daily and hiPSC were gently passaged every 5-6 days by mechanical selection or bulk passaged using non-enzymatic reagents (i.e., Versene solution (ThermoFisher Scientific) or Phosphate-Buffer-Saline (PBS)-based enzyme-free cell dissociation buffer (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were started by the addition of ATP (0.5 mM final) and quenched after 2 min at 30 °C with EDTA (100 mM) and 4X LDS buffer (Invitrogen). Reactions were run on 4-12% Bis-Tris gel in MOPS buffer (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3-9) or 5 µl (IP: Figure 2A-2C and input: Figure 2-9) RNAse A/T1 (Thermo Scientific #EN0551) and incubation the beads at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... the automatic switching of a ten-port valve eluted the trapped mixture on areversed phase column (Biobasic-C18, 0.180 i.d., 100 mm length, 5 μm particle size, Thermo Fisher Scientific) for the separation with an acetonitrile gradient (eluent A ...
-
bioRxiv - Immunology 2020Quote: ... cells were washed with ice cold sterile 1x DPBS and incubated for 5 min in 1ml TRIzol (Invitrogen, Leicestershire, UK) at RT ...
-
bioRxiv - Cell Biology 2019Quote: ... 10-15% of RIPA-soluble fraction and 2.5-5% of insoluble fraction were loaded on 4-12% Bis-Tris gels and run using MOPS buffer (Life Technologies) and visualized by western blotting on PVDF ...
-
bioRxiv - Neuroscience 2019Quote: ... The samples were heated to 95°C for 5 minutes prior to electrophoresis through a 12% Bis-Tris precast gel (Invitrogen), followed by transfer to a nitrocellulose membrane by wet blotting ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... the proboscis was inserted into a 20 μL tip containing 5 μL of Fetal Bovine Serum (FBS) (Gibco, MA, USA). After 30 min ...
-
bioRxiv - Immunology 2019Quote: ... In EdU-only labelling experiments mice were injected with 1 mg EdU (5-ethynyl-2’-deoxyuridine, cat #E10415, ThermoFisher Scientific) intraperitoneally and were killed one hour after injection ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 μg of each antibody was diluted in 30 μl PBS-T and then incubated with 5 μl protein A-coated magnetic beads (30 mg/ml, Dynabeads, 10002D, Invitrogen) for 30 min ...
-
bioRxiv - Genomics 2019Quote: ... containing 5 μl nuclease-free water with bovine serum albumin (1 mg/μl, Fermentas) and RNaseOut 20 U (Life Technologies). The plates were placed on a precooled rack and stored at −80 °C until analysis ...
-
Inhibition of nucleotide synthesis promotes replicative senescence of human mammary epithelial cellsbioRxiv - Systems Biology 2019Quote: Metabolites were detected and quantified as area under the curve based on retention time and accurate mass (≤ 5 ppm) using the TraceFinder 3.3 (Thermo Scientific) software ...
-
bioRxiv - Molecular Biology 2019Quote: Three specific 5’ RACE primers and two 3’ RACE primers were designed according to the Race kit instructions (Invitrogen & Clontech) (Table S1) ...
-
bioRxiv - Biochemistry 2020Quote: ... Grids were blotted for 3 seconds at 0 force and 5 seconds wait time before being plunge vitrified in liquid ethane using a MarkIV Vitrobot (ThermoFisher). The blotting chamber was maintained at 22°C and 100% humidity during freezing.
-
bioRxiv - Microbiology 2019Quote: ... falciparum cell lines were cultured in 5% human O+ red blood cells (Australian Red Cross blood service) in RPMI-GlutaMAX-HEPES (Invitrogen) supplemented with 5% (v/v ...
-
bioRxiv - Molecular Biology 2019Quote: ... were used for studies of INS-1 cells treated with CSE or AC extract with or without 5 mM N-Acetyl Cysteine (NAC) from Invitrogen; Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2019Quote: HEK293 cells (ATCC Cat# CRL-1573) were maintained at 37° C and 5% CO2 in 1X DMEM medium (Thermo Scientific; Waltham ...
-
Targeting MOG to skin macrophages prevents EAE in macaques through TGFβ-induced peripheral tolerancebioRxiv - Immunology 2019Quote: Macaque PBMCs (2×106cells/well) were cultured for 44 hr (37°C, 5% CO2) in 500 μl of IMDM (ThermoFisher) supplemented with 10% FCS and 1% penicillin/streptomycin in the presence or absence of 20 μg/ml of rhMOG ...
-
bioRxiv - Genetics 2019Quote: ... Lysates were prepared from harvested cells in lysis buffer (50mM Tris pH7.5, 150mM NaCl, 0.5% Triton X-100, 5 mM EDTA) containing phosphatase (Thermo Scientific; 78428) and protease inhibitors (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... 100 U/ml−1 penicillin/streptomycin and 5% (v/v) heat-inactivated fetal bovine serum (all supplements were from Invitrogen). Cells were maintained at 37°C in an atmosphere of 5% CO2 ...
-
bioRxiv - Physiology 2020Quote: ... blot dried for 5 seconds and immediately placed in Roswell Park Memorial Institute media - 1640 (RPMI-1640, ThermoFisher Scientific Australia) containing 3% (w:v ...
-
bioRxiv - Immunology 2019Quote: ... Aim2 inflammasome activation in LPS-primed J774A.1 cells was induced by transfection of 5 μg of poly(dA:dT) using Lipofectamine 2000 (Thermo Fisher) 6 h prior to sample collection [35] ...
-
bioRxiv - Molecular Biology 2019Quote: ... Coverslips were washed with 50% formamide/2xSSC at 37°C and then twice with 2xSSC/0.1% TX100 for 5 minutes before mounting using prolong gold antifade with DAPI (ThermoFisher Scientific).
-
bioRxiv - Synthetic Biology 2020Quote: ... A type IIS assembly reaction was set up into a 0.2 mL tube (5 µL nuclease-free H2O, 1 µL 10x Tango Buffer (Thermo Fisher), 0.5 µL mg/mL bovine serum albumin (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5×105 MDCK II cells were seeded into 24 mm transwells one day before transfection using Lipofectamine 3000 Reagent (Invitrogen). 6 h post transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were washed 3 times with PBS (5 min, RT) and mounted using ProLong® Gold antifade mountant (ThermoFisher, P36930). STED microscopy was performed using a 100× objective on the STEDYCON 2-colour STED imaging system (Abberior Instruments) ...