Labshake search
Citations for Thermo Fisher :
9251 - 9300 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... MSCs were expanded in standard culture conditions (37°C, 21% O2, 5% CO2) in α-MEM (Life Technologies, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2021Quote: ... and cells were collected by peritoneal lavage with 5 mL ice-cold DMEM medium (Gibco, Life Technologies, Grand Island, NY). Peritoneal exudate cells were centrifuged at 200x g and 4oC ...
-
bioRxiv - Biochemistry 2021Quote: ... and cells were collected by peritoneal lavage with 5 mL ice-cold DMEM medium (Gibco, Life Technologies, Grand Island, NY). Peritoneal exudate cells were centrifuged at 200x g and 4oC ...
-
bioRxiv - Biochemistry 2021Quote: ... Unbound primary antibodies were removed by washing four times for 5 min in PBS-T at room temperature followed by incubation with secondary antibodies (Alexa Fluor 546; 1:1000; Invitrogen) and DAPI for 45 min ...
-
bioRxiv - Biochemistry 2021Quote: ... and samples were incubated at 70°C for 5 minutes and loaded onto Bis-Tris 4-12 % gradient gels (ThermoFisher). Bands were stained by CBB and relative band intensity was quantified by scanning and semi-automated analysis in ImageQuant (GE Healthcare).
-
bioRxiv - Molecular Biology 2021Quote: ... aliquots of 10 x 104 uninfected macrophages suspended in 10 mL SFB-free DMEM were incubated with: i) 5 µg of lipofection pBlueBacHis2/CAT plasmid (Invitrogen); ii ...
-
The E3 ubiquitin-protein ligase MDM2 is a novel interactor of the von Hippel-Lindau tumor suppressorbioRxiv - Biochemistry 2020Quote: ... Immune complexes were finally washed 3 times with lysis buffer and eluted by incubating the beads (5’ at 70°C) in 30 μl in 1X NuPAGE LDS sample buffer (Invitrogen) plus 0,1 M DTT ...
-
bioRxiv - Biochemistry 2020Quote: ... and neurons were dissociated in a buffer containing papain and cultured at 5 × 104 cells/cm2 in Neurobasal Medium (Cat#21103049, Gibco/Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Ibaragi, Japan) were cultured in RPMI 1640 medium (Wako Chemicals, Osaka, Japan) supplemented with 5% fetal bovine serum (FBS; GIBCO) at 37°C under humidified air containing 5% CO2 ...
-
bioRxiv - Biochemistry 2020Quote: ... An integrated loading pump was used to load peptides onto a trap column (Acclaim PepMap 100 C18, 5 um particles, 20 mm length, ThermoFisher) at 5 µL/min ...
-
bioRxiv - Neuroscience 2020Quote: HEK293T cells were cultured at 37°C in air containing 5% CO2 in DMEM (Biological Industries) supplemented with 10% (v/v) fetal bovine serum (Gibco) and penicillin (100 unit/mL)-streptomycin (0.1 mg/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were blocked in PBS-T containing 5% NDS and then incubated overnight at 4°C with rabbit anti-PSD95 (1:1000, Invitrogen/ThermoFisher) and guinea pig anti-vGlut2 (1:10,000 ...
-
bioRxiv - Immunology 2020Quote: ... and anti-CD127-PE-Cy5 (clone eBioRDR5; 5 μL; cat. # 15-1278-42) all from Thermo Fisher (Supplementary Fig. 4). mAbs for chemokine receptors (i.e ...
-
bioRxiv - Immunology 2020Quote: ... was added using the primers 5’ GACCGTCTCGAGAAAAGAAAAGTCTTTGGACGATGTGAGC and 3’ GTGACTGAATTCTTACTAATGGTGATGGTGGTGATGGCCGCTCAGCCGGCAGCCTCTGA TCCAC and the product was subsequently cloned into the vector pPIC9K (Invitrogen) between the Xho I and EcoR I sites by doing a three-way ligation (EcoR I ...
-
bioRxiv - Neuroscience 2021Quote: ... A micropipette with a tip diameter between 30-40µm was used to inject 0.5 µl of 5% FluoroRuby (MW 10,000; ThermoFisher Scientific, Leicester, UK) dissolved in 0.9% saline at a depth of 0.5mm ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were washed at least 5 times 20 min and transferred to 0.25% PBT with 1:400 TO-PRO-3 (ThermoFisher #T3605) for 2 nights ...
-
bioRxiv - Neuroscience 2020Quote: We quantified vWA5A and ADAMTS19 protein levels by lysing 5 x 105 cells using Pierce IP Lysis Buffer (Thermo Fisher) following the recommended protocol and measured human vWA5A and ADAMTS19 with high-sensitivity ELISA kits (both from MyBioSource ...
-
bioRxiv - Neuroscience 2021Quote: ... was added to cells in phenol-free DMEM:F12 medium and incubated at 37oC in a 5% CO2 cell culture chamber (Forma Series II Water Jacket; ThermoFisher Scientific) for 30 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were washed 5-6 times over 2 hours in PBT at room temperature and incubated with secondary antibodies (Invitrogen) diluted in NGS-PBT for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... total RNA was reverse-transcribed with 0.5ug of poly (T) adaptor containing a 5’-end universal tag sequence and SuperScript™ II Reverse Transcriptase (Thermofisher). Specific miRNA primers ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were centrifuged for 5 min at 10,000 xg and the protein content of the supernatant was determined using a BCAassay kit (Thermo Scientific). The c-di-AMP concentrations are presented as ng c-di-AMP/mg C ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were centrifuged at 130 × g for 5 min and the pellet was resuspended in culture medium consisting of Neurobasal medium with 2% B27 (Invitrogen), 1% L-Glutamine (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was carried out in unsupplemented NBA using 500 ng of the luciferase reporter construct and 20 ng of a normalizer plasmid pGL4.83-mPGK-hRLuc at 5-6 DIV using Lipofectamine 2000 (Thermo Scientific) with DNA to Lipofectamine ratio of 1:2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... After dispensing 5 μL of these master mixes to each well of a 384 well plate (Applied Biosystems PN 4309849) using a Mantis Liquid Handler (Formulatrix) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were blocked in 1% BSA and then stained with indicated antibodies against Claudin-5 (Invitrogen 35-2500 1:50), Ad5 (Abcam ab6982 1:100) ...
-
bioRxiv - Cell Biology 2021Quote: ... coverslips were washed three times in 1x PBS for 5 min and incubated with secondary antibodies [donkey anti-rabbit Alexa594 (1:1000, #A21207, Invitrogen) and goat anti-mouse Alexa488 (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... were transformed into DH10EmBacY chemically competent cells with heat shock at 42°C for 15 seconds followed by incubation at 37°C for 5 hours in S.O.C media (Thermo Fisher Scientific). The cells were then plated on LB-agar plates containing kanamycin (50 μg/ml) ...
-
bioRxiv - Cell Biology 2021Quote: ... for 2 hours at RT and were exposed to ECL imager after 5 min incubation with ECL reagent (Thermo Fisher).
-
bioRxiv - Cell Biology 2021Quote: ... 2X SSC) for 5 min and counter stained with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole; Life Technologies). Coverslips were mounted in imaging buffer (3.7 μg/μl glucose oxidase and 1U catalase in equilibration buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were washed with 1X PBS 3 times for 5 minutes and then mounted with Prolong Glass Antifade mountant (Invitrogen). Confocal Z-stack images were acquired using Nikon SoRA spinning disk microscope ...
-
bioRxiv - Cancer Biology 2021Quote: ... FBS was dialyzed in-house (against 0.15M NaCl until glucose reached <5 mg/dL) using 10k MWCO dialysis tubing (Fisher Scientific) at 4°C for 6 h ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were pelleted by centrifugation at 300RCF for 5 min and re-suspended at a density of 6,000 cells/µl in warm Neurobasal-A (Gibco #10888022) + 1X B27 supplement (Gibco #17504044 ...
-
bioRxiv - Cancer Biology 2020Quote: Cells were sorted into 96-well plates at 50 cells/well in 5 µL CellsDirect™ 2× Reaction Buffer (Invitrogen). Cells lysates were reverse transcribed using Superscript™ III (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Wells were consecutively washed two times for 5 min in washing buffer before incubation with secondary antibodies (Alexa Fluor-488 goat anti-mouse IgG, Invitrogen, A-11029 ...
-
bioRxiv - Cell Biology 2021Quote: ... Passages were made before reaching confluence every 2-3 days by two washes with PBS (15 min each) and incubation in trypsin 0.05% for 5-10 min (Trypsin Cat#15400054, Thermo Fisher). MDCK cells stable transfected clones (MDCK-Shh ...
-
bioRxiv - Cell Biology 2021Quote: ... we washed the chambers three times for 5 minutes in PBS and mounted them in ProLong Diamond Antifade Mountant (ThermoFisher). Images were acquired using a Leica DMI6000 inverted microscope with an integrated confocal module SP5 (Leica Microsystems ...
-
bioRxiv - Cell Biology 2021Quote: ... with 5% CO2 at 37°C and propagated in the same media containing penicillin-streptomycin-glutamine (1:100 dilution of Gibco Penicillin-Streptomycin-Glutamine 100X ...
-
bioRxiv - Neuroscience 2020Quote: ... recombinant human epidermal growth factor (5 ng/ml) and additionally supplemented with freshly added recombinant human fibroblast growth factor-basic (1 ng/ml; Gibco). hCMEC/D3 cells used for the experiments were between passages 6 and 11 ...
-
bioRxiv - Neuroscience 2020Quote: ... The tissue was then transferred to 5 mL pre-warmed (20 min at 37°C) Trypsin/EDTA (Life Technologies, USA) supplemented with 132 mM trehalose (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: MCF10A cells were obtained from ATCC and cultured in DMEM/F-12 media with 5% horse serum (Thermo Fisher Scientific), 20 ng/ml human EGF (Peprotech) ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells selected with CD11b microbeads were plated onto poly-L-lysine precoated 96-well or 386-well plates at 3x104 cell/cm2 density and were cultured at 37 °C in a 95% air/5% CO2 incubator in DMEM/Glutamax medium (#31966-021, Gibco) supplemented with 10% FBS (fetal bovine serum ...
-
bioRxiv - Plant Biology 2021Quote: ... pistils and young seeds (7 DAP from CT and 5 DAP from HT) were isolated following a protocol for Trizol (Invitrogen). RNA from 26 DAP seeds was isolated using a NucleoSpin RNA Plant and Fungi kit (Macherey-Nagel ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5 mM EDTA and 0.5 % NP40) complemented with 1 × protease inhibitors (Pierce Protease Inhibitor Mini Tablets, EDTA-Free, Thermo Scientific) and 2 U Turbo DNase (Ambion ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μm) and a C18 analytical column (PepMapAcclaim C18, 50 cm × 0.75 mm, 2 μm, both Dionex-Thermo Fisher Scientific), applying a linear gradient from 2 to 35% solvent B (80% acetonitrile ...
-
bioRxiv - Biochemistry 2020Quote: ... 4390771 ID: s69588 and s69586) or ERK3 siRNA (5 pmol; catalog number: 4390771 ID: s78451) and Lipofectamine 2000 (2 µl) (Invitrogen) and cells incubated for 19 h ...
-
bioRxiv - Cell Biology 2021Quote: ... DAPI was used as a counterstain at 300nM in 1xPBS for 5 minutes at room temperature and then mounted in mounting medium ProLong Diamond Antifade (ThermoFisher). Slides were imaged on a Keyence BZ-X810 microscope using the 10X objective.
-
bioRxiv - Biochemistry 2020Quote: ... 5 washes of TBST were done followed by development using 1-Step Ultra TMB-ELISA Substrate Solution (ThermoFisher Scientific, 43028) and quenching with 1N HCl ...
-
bioRxiv - Cell Biology 2021Quote: ... 5–12 µl of protein lysate was loaded into pre-cast protein gels (4–12 % Bolt Bis Tris Plus, ThermoFisher) together with 10 µl of the molecular marker (PageRuler prestained ...
-
bioRxiv - Cell Biology 2021Quote: ... Human islets were loaded with 5 µg/µL of the Ca2+-sensitive dye Fluo-4 (1923626, Invitrogen, Thermo Fisher Scientific) for 60 min before being transferred to a recording chamber ...
-
bioRxiv - Cell Biology 2021Quote: ... Human islets were loaded with 5 µg/µL of the Ca2+-sensitive dye Fluo-4 (1923626, Invitrogen, Thermo Fisher Scientific) for 60 min before being transferred to a recording chamber ...