Labshake search
Citations for Thermo Fisher :
9101 - 9150 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: HEK-293 cells used in the endogenous UPF1LL knockdown and RNA-seq experiments were received from ATCC (CRL-3216) and maintained at 37°C and 5% CO2 in DMEM with 10% FBS (Gibco) and 1% pen/strep ...
-
bioRxiv - Molecular Biology 2021Quote: ... in Minimum essential medium (MEM), glutamine-free based Neuronal growth medium (5% fetal bovine serum, 2% B27, 1% Glutamax (100×, Invitrogen), 2 % 1 mol/L d-glucose ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated from Hela cells (n = 3) subjected to EBSS-induced autophagy and treatment with 5 μM UNC0638 for 12 hours using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: HEK293T cells were grown at 37 °C and 5 % CO2 in DMEM supplemented with 10% tetracycline-free fetal bovine serum and 1% Penicillin-Streptomycin (Invitrogen). Cells were transfected with the LentiX VSV-G transfection mix (Clontech ...
-
bioRxiv - Molecular Biology 2021Quote: ... TK6 and MCL-5 cells (Crespi et al. 1991) were cultured in suspension in 1x RPMI 1640 medium with L-glutamine (Invitrogen) supplemented with 10% horse serum (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... We labeled the purified RLC with 10 molar excess of 5-((((2-Iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (IAEDANS, Invitrogen) or dabcyl C2 maleimide (AnaSpec ...
-
bioRxiv - Molecular Biology 2021Quote: ... were used for each luciferase and two reference genes were also quantified with qRT-PCR using an ABI QuantStudio 5 Real-Time PCR System (ThermoFisher). Three technical replicate reactions were performed for each unique primer set for each sample.
-
bioRxiv - Molecular Biology 2021Quote: J1 mES cells were grown on glass coverslips and incubated for 1h (37°C, 5% CO2) with EU from the Click-iT RNA Alexa Fluor 594 imaging kit (C10330, Invitrogen). Cells were fixed with 3,7% formaldehyde in PBS 1× for 15min at room temperature and permeabilized with 0.5% Triton X-100 in PBS 1× for 15min at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... For RNA-extraction: Three replicates of 10 (Oil and Nic) or 5 (Phe) pair of eyes were either added to RNAlater (Invitrogen) (Oil ...
-
bioRxiv - Molecular Biology 2019Quote: ... 200 ul of sample was taken out and 20 μl of 5 M NaCl and 10 μl of 10 mg/ml proteinase K (Invitrogen) was then added followed by an overnight incubation on 65°C ...
-
bioRxiv - Biophysics 2022Quote: ... the cells were resuspended at 5-10×106 cells per ml in HBSS without Ca2+ and Mg2+ (Thermo Fisher Scientific) to ensure their quiescence prior to stimulation by contact with IgG.
-
bioRxiv - Biophysics 2022Quote: Isolated carboxysomes were diluted to 5 mg mL-1 and denatured using 4X Bromophenol blue buffer (Fisher Scientific, United States). The samples were heated at 95°C for 10 mins ...
-
bioRxiv - Cell Biology 2022Quote: ... 3x105 cells were spun down at 200 g for 5 min and resuspended in 1 mL L-15 media (Gibco) containing 1μL SiR-tubulin (Cytoskeleton Inc. ...
-
bioRxiv - Cell Biology 2022Quote: 100,000 BHK cells were plated into a 6-well plate and transfected with 5 nM of siRNA pool (siTOOL) against Uhrf1 or Usp7 by Lipofectamine 3000 (Invitrogen). After 24 or 48 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were boiled at 95 °C for 5 min and separated by SDS–PAGE electrophoresis using 8-16% Tris-Glycine gels (Invitrogen) at 225 V for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... and under a 12-hour day/night photoperiod schedule (Percival Scientific, IA, USA) with 5% dextrose (w/v) and 0.05% para-Aminobenzoic acid (w/v) (Thermo Fisher). Mosquito oocysts were checked at 10-days post-infection ...
-
bioRxiv - Immunology 2021Quote: ... 1% PenStrep and 8 μg/mL puromycin (to ensure retention of TMPRSS2) with 5% CO2 in a 37°C incubator (ThermoFisher). Cells were trypsinized using 0.05% trypsin and plated to 40,000 cells/well ...
-
bioRxiv - Genomics 2019Quote: ... Soluble material was incubated with 3-5 μg of antibody bound to 50 μl protein A or protein G Dynabeads (Invitrogen) and incubated overnight at 4 °C ...
-
bioRxiv - Genomics 2020Quote: ... Cells were washed three times with 0.01% Triton X-100 in PBS for 5 minutes each and then incubated in blocking solution containing corresponding secondary antibodies labeled with Alexa fluorophores (Invitrogen) for 1 hour at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... qPCR was performed in duplicates in 384-well optical plates in a QuantStudio 5 Real-Time PCR system (ThermoFisher Scientific) using default settings ...
-
bioRxiv - Genomics 2020Quote: ... RNA were converted to cDNA by adding a 5-μl enzyme mix containing 500ng Actinomycin D (A7592, Thermo Fisher Scientific), 0.5μl RNase inhibitor ...
-
bioRxiv - Immunology 2021Quote: ... RNA samples were first incubated at 65°C for 5 min in the presence of 0.5 mM dNTPs and 2.5 µM oligo(dT)20 (Life Technologies-Invitrogen). Subsequently ...
-
bioRxiv - Genomics 2020Quote: ... and either Alexa-Fluor 594-coupled Wheat Germ Agglutinin (WGA) for WT cells or Alexa-Fluor 647-coupled WGA for Fmr1-KO cells (5 μg/ml; Invitrogen) in D-PBS for 20 and 10 min ...
-
bioRxiv - Genomics 2020Quote: Neuronal suspensions were labelled at 37°C with a combination of the Fluo-4 calcium indicator (5 μg/ml; Invitrogen) and either Alexa-Fluor 594-coupled Wheat Germ Agglutinin (WGA ...
-
bioRxiv - Immunology 2021Quote: ... Epithelial cells were separated from the lamina propria via a 40-min incubation with gentle agitation in dissociation buffer (HBSS with 15 mM HEPES (Thermofisher, 5 mM EDTA (Invitrogen), 10% FBS (Gibco) ...
-
bioRxiv - Biochemistry 2019Quote: ... were grown to 80% confluence at 37°C with 5% CO2 on 78 cm2 dishes using DMEM high glucose (Dulbecco’s Modified Eagle, glucose 4.5 g/L, Gibco, 41966–029), 10% bovine serum (Gibco ...
-
bioRxiv - Immunology 2019Quote: ... the mice received a tail vein injection containing of either vehicle alone or KKO or DG-KKO or TRA or DG-TRA at doses of 5 mg/kg diluted in 200 μl of phosphate buffered saline (PBS with CaCl2 and MgCl2, Gibco). Five hours after LPS treatment ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was cloned between 5’ KpnI and 3’ EcoRI sites of the pMT/V5-His vector (Invitrogen). In-frame Tag-RFP-T gene was then introduced at the 3’ end of γ-tubulin gene between 5’ EcoRI and 3’ NotI sites ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was then inserted into the 5’ SpeI and 3’ EcoRI sites of the pMT/V5 His-B vector (Invitrogen) containing in-frame mTurquoise2 gene at the 5’ end ...
-
bioRxiv - Cell Biology 2019Quote: ... 5) We then transformed the DNA into ElectroMAX™ DH1OB™ T1 R cells (Life Technologies, prod. number 12033-015) using electroporation and recovered the colonies on LB plates supplemented with 100μg/ml Blasticidin ...
-
bioRxiv - Cell Biology 2019Quote: ... The fluorgenic substrate (5 μM) was mixed with control and test samples in 96 well plates (Black wall plate, Nunc), incubated for 1 h at 37 °C ...
-
bioRxiv - Neuroscience 2019Quote: ... post-axotomy cultures were loaded with lipophilic dye N-(3-trimethylammoniumpropyl) -4-(6-(4-(diethylamino) phenyl) hexatrienyl)pyridinium dibromide (FM 5–95; Invitrogen) using KCl mediated depolarization as described previously (Taylor et al ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were then washed 4 times for 30 minutes in 1x PBS/0.3% Triton X-100/5% NDS and then mounted with Molecular Probes ProLong® Diamond anti-fade mounting medium (Invitrogen). Images where captured on a Zeiss confocal LSM780 with Zen software ...
-
bioRxiv - Microbiology 2019Quote: ... was carried out by taking 500 µl of the culture from respective time points into Eppendorf tubes and incubated them with 5 µM 3’-(p-hydroxyphenyl fluorescein (HPF; Invitrogen) (0.5 µl of HPF from 5 mM stock ...
-
bioRxiv - Microbiology 2019Quote: ... double-stranded cDNA was synthesized from 5 μg of total RNA using the Superscript double-stranded cDNA synthesis kit (Invitrogen). Following phenol/chloroform extraction and ethanol precipitation ...
-
bioRxiv - Developmental Biology 2019Quote: The E11.5 Yolk sacs from miR144/451+/GFP mouse embryos were first collected in 1xPBS+10% Fetal Bovine Serum (10270106, Gibco). Upon dissection they were fixed in 4% Paraformaldehyde solution in PBS (sc-281692 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 μm) and a C18 analytical column (PepMapAcclaim C18, 50 cm x 075 mm, 2 μm, Dionex-Thermo-Fisher Scientific), applying a linear gradient from 2 to 35 % solvent B (80 % acetonitrile ...
-
bioRxiv - Biochemistry 2020Quote: ... De-phosphorylated tsRNA or synthetic RNA (scrambled) were 5’-thiolated by incubation with 0.5 U/µL polynucleotide kinase (ThermoFisher Scientific) in the presence of 0.5 mM ATPγS (SIGMA ...
-
bioRxiv - Developmental Biology 2019Quote: ... and sequenced with the primers indicated in Extended Data Table 5 using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a 3130xl Genetic Analyzer (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2019Quote: ... Porcine jejunum epithelial cell line IPEC-J2 (ACC-701) was grown in DMEM F12 medium supplemented with 10% FBS and 5% penicillin/streptomycin (P/S, Gibco) in 75 cm2 culture flasks ...
-
bioRxiv - Cell Biology 2019Quote: ... Point-spread functions for deconvolution were experimentally measured using 200nm tetraspeck beads adhered to 5 mm glass coverslips (T7280, Invitrogen) for 488 excitation wavelength.
-
bioRxiv - Cell Biology 2019Quote: ... CENP-F-Mut1 and CENP-F-Mut2 cells were grown in a humidified incubator at 37°C and 5% CO2 in DMEM (Gibco) containing 10% FCS (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: ... TCam-2 cells were grown in 37°C and 5% CO2 in Roswell Park Memorial Institute (RPMI, Life Technologies 61870044) 1640 medium supplemented with 10% FBS (GE Healthcare HyClone SH30071 ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Immunology 2019Quote: RAW 264.7 macrophages (ATCC) were cultured at 37°C with a humidified atmosphere of 5% CO2 in DMEM (Thermo Fisher) with 10% FBS (Sigma Aldrich ...
-
bioRxiv - Microbiology 2019Quote: ... A 2 μl volume of cDNA diluted 1:4 (IAV) or 1:5 (reovirus) in molecular biology grade water (Invitrogen) was added to the 384 well plate ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by three washes in PBS (5 minutes) and incubation with Hoechst 33258 and Alexa-labelled secondary antibodies (Thermo Fisher) in blocking buffer for 30 minutes ...
-
bioRxiv - Developmental Biology 2019Quote: ... E8 medium was replaced daily and hiPSC were gently passaged every 5-6 days by mechanical selection or bulk passaged using non-enzymatic reagents (i.e., Versene solution (ThermoFisher Scientific) or Phosphate-Buffer-Saline (PBS)-based enzyme-free cell dissociation buffer (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were started by the addition of ATP (0.5 mM final) and quenched after 2 min at 30 °C with EDTA (100 mM) and 4X LDS buffer (Invitrogen). Reactions were run on 4-12% Bis-Tris gel in MOPS buffer (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3-9) or 5 µl (IP: Figure 2A-2C and input: Figure 2-9) RNAse A/T1 (Thermo Scientific #EN0551) and incubation the beads at 37°C for 30 minutes ...