Labshake search
Citations for Thermo Fisher :
9151 - 9200 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Two microgram RNA was reverse transcribed into cDNA using random primers and M-MLV reverse transcriptase (Invitrogen, CA, USA). RT-qPCR was performed in triplicate with the Eco Real-Time PCR System (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was synthetized from 200-500 ng of RNA reverse transcribed using Oligo dT primers and SuperScript II (Invitrogen). qPCR was carried out using PowerUp SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Microbiology 2022Quote: Reverse transcription of total RNA was performed on selected samples with 5 μg of RNA and 12.5 ng/μl of random hexamer primer (Invitrogen) using SuperScript™ III reverse transcriptase (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized from 1μg of RNA with oligo-dT primers using RevertAid First Strand cDNA Synthesis Kit (ThermoFisher). Quantitative Polymerase Chain Reaction (qPCR ...
-
bioRxiv - Physiology 2022Quote: ... using primers (ESM Table 3) at a final concentration of 200 nM with either platinum Taq (ThermoFisher Scientific, Sweden) or OneTaq (New England Biolabs ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Cancer Biology 2022Quote: ... annealing and extension at 60°C for 60s using Hmox-1 specific Taqman primer (Applied Biosystems, San Francisco, CA) and TaqMan Universal Master Mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: ... Total RNA was reverse-transcribed with gene-specific primers (2µM final concentration) using Superscript III reverse-polymerase (Life Technologies). This cDNA template was used for real-time PCR using the TaqMan Fast Advanced Mastermix (Life Technologies) ...
-
bioRxiv - Biophysics 2019Quote: ... 2 pmol strand-specific cDNA primer (Figure S5A) and 200 units SuperScript IV reverse transcriptase (ThermoFisher; Cat No.18090010) in RT buffer (50 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2020Quote: ... The RNA (10 μg) was reverse-transcribed into cDNA using Superscript II with oligo (dT) primers (Thermo Fisher Scientific). The cDNA was amplified in a thermal cycler 7500 Fast (Applied Biosystems ...
-
bioRxiv - Genomics 2019Quote: ... The biotinylated primers and undigested library members were removed using Dynabeads M-270 Streptavidin (Thermo Fisher Scientific, Waltham, MA), using the recommended “Immobilize nucleic acids” protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... and the RNA was reverse transcribed with random primers using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems). qPCR analyses were performed using the PowerUp SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Pathology 2020Quote: ... reverse primer 5’-cgaactCCG AGT TTA TAC TGC CCA GTT CG-3’ with FAM-labeled LUX (Cat. no19450335, Invitrogen). The mouse Vascular Endothelial Growth Factor assay ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR reactions were prepared using gene-specific primers (Table S4) and Platinum SYBR Green qPCR Supermix-UDG (Thermo Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNase I-treated RNA (0.5 μg) was reverse transcribed with random primers using Superscript III enzyme (Invitrogen, Carlsbad, CA) for one hour at 50°C ...
-
bioRxiv - Microbiology 2020Quote: ... Primers targeting the three capsid genes were designed based on these bracketing conserved regions and ordered from Invitrogen (Guangzhou).
-
bioRxiv - Biochemistry 2020Quote: ... Primers were designed to flank the S267 codon by approximately twenty nucleotides and were ordered from Invitrogen (Carlsbad, CA). Mutated cDNA was then transformed into One Shot TOP10 cells (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... and about 1-3.5 μg of the RNA was taken for cDNA synthesis using oligodT primers (Thermo Fisher Scientific), RevertAid reverse transcriptase (Thermo Fisher Scientific ...
-
Investigations on regulation of miRNAs in rice reveal [Ca2+]cyt signal transduction regulated miRNAsbioRxiv - Plant Biology 2021Quote: ... 2 μg of RNA was incubated with 100 pmoles of either oligodT primer (Eurofins Genomics) for total RNA or miR_oligodT primer (Eurofins Genomics) for small RNA using the SuperscriptII cDNA synthesis kit (Invitrogen). All the primers have been enlisted in Supplementary Table S1.
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Plant Biology 2019Quote: ... and were sequenced using both the forward and reverse primers via capillary sequencing on an ABI3730 machine (Applied BioSystems). Raw sequence reads viewed in SnapGene version 1.4 and were trimmed and refined by eye from the peak trace where necessary ...
-
bioRxiv - Plant Biology 2019Quote: ... Complementary DNA (cDNA) was synthesised from the DNase-treated RNA using random primers and SuperScript III reverse transcriptase (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was reverse transcribed into cDNA using random hexamer primers and SuperScript III first-strand synthesis kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... This fragment had primer-incorporated XbaI and NotI sites and was inserted into a modified pcDNA3.4 vector (Thermo Fisher), which contained a custom polylinker (with XbaI and NotI restriction sites) ...
-
bioRxiv - Neuroscience 2020Quote: ... mRNA was reverse transcribed using polyT primers with the SuperScript™ III First-Strand Synthesis System (Thermo Fisher scientific) to obtain whole embryo cDNA ...
-
bioRxiv - Plant Biology 2021Quote: ... IMPa8 and IMPa9 were amplified using gene-specific primers (Supplemental Table 3) and cloned into pCR8 (Thermo Fisher Scientific), which were then recombinated into pC-TAPa via LR clonase.
-
bioRxiv - Cancer Biology 2021Quote: ... Precipitated RNAs were quantified using Taqman miRNA assays with custom primers for detection of 5’-tRFCys (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: Total messenger RNA was extracted from FACS-sorted cells and isolated glomeruli using NucleoSpin RNAII kit and NucleoSpin RNA Plus XS (both Machery-Nagel) according to the manufacturer’s instructions and was reverse transcribed with random hexamer primer (Invitrogen) and Revert Aid (Thermo Fisher) ...
-
bioRxiv - Genomics 2020Quote: ... These mixtures were measured in triplicate for each sample-primer combination with a ViiA 7 qPCR machine (Thermo Fisher)
-
bioRxiv - Microbiology 2021Quote: ... 2.5-µl of RNA at 50-100 ng/µl was mixed with 0.5 µl of 100-ng/µl random hexamer primers (Invitrogen), 0.5 µl of 10 mM deoxynucleoside triphosphates (dNTPs ...
-
bioRxiv - Microbiology 2020Quote: ... a nested qPCR was performed using primers AA55M and L and the SYBR green master mix (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2022Quote: ... amplified on a cDNA template with respective primers (Supplementary Table S2) and DECAprime™ II labeling kit (Thermo Scientific) and [α-32P] dATP (SRP-203 ...
-
bioRxiv - Neuroscience 2022Quote: A total of 250 ng RNA was reversed transcribed using stem-loop Multiplex primer pools (Applied Biosystems, Dublin, Ireland). Reverse-transcriptase-specific primers for mmu-miR-335-5p (Applied Biosystems miRNA assay ID 000546 ...
-
bioRxiv - Bioengineering 2022Quote: ... the beads-mRNA complex was resuspended in 20μl of reverse transcription mastermix (without any primer) from Superscript IV First Strand cDNA Synthesis Kit (Invitrogen). The Oligo-dT on beads served as primers for the reverse transcription reaction ...
-
bioRxiv - Immunology 2022Quote: ... Amplification of cDNA was performed using an ISPCR primer (59-AAGCAGTGGTATCAACGCAGAGT39) and KAPA HiFi HotStart ReadyMix (Thermo Fisher Scientific). Amplified cDNA was cleaned up three times using RNAClean XP SPRI beads ...
-
bioRxiv - Immunology 2022Quote: ... RT was performed on 200 ng of total RNA with random hexamers or with specific primer (10μM) (sequence available in Supplementary Fig. S2.) using superscript III enzyme (Invitrogen). As control ...
-
bioRxiv - Neuroscience 2022Quote: ... primers and probes used for housekeeping genes and target genes we used the following assays: UBE3A mRNA (Hs001666580_m1, Invitrogen), Gapdh (Mf04392546_g1 ...
-
bioRxiv - Microbiology 2022Quote: ... with primers designed in-house (Table S3) that contain BP overhangs and recombined into pENTR using BP Clonase (ThermoFisher). Guide-resistant pENTR or pShuttle constructs were generated by modification of PAM sites by introducing silent mutations using site directed mutagenesis (Table S3) ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized from ino-4 mRNA using Superscript II reverse transcriptase and oligo dT primers (ThermoFisher, Waltham, MA). The specific cDNA was amplified by PCR using Phusion DNA polymerase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were combined with 1 µl of a mix containing 50 mM Tris pH 7.5 and 500 ng/µl random primers (Invitrogen), incubated at 70°C for 10 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... were constructed by PCR from N2 cDNA or N2 genomic DNA with primers flanked with attB1 and attB2 recombination sites and cloned into pDONR_221 vector (Invitrogen) by BP recombination ...
-
bioRxiv - Neuroscience 2022Quote: ... and qPCR was performed with 200nM each of forward and reverse primers and PowerUp SYBR Green Master Mix (ThermoFisher) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... Gene expression analysis was performed on duplicate samples with the following primers: Hs04931857_m1 (IL33) and Hs02786624_g1 (GAPDH) using the TaqMan (Applied Biosystems) technology on a StepOnePlus™ (Applied Biosystem ...
-
bioRxiv - Physiology 2022Quote: ... Reverse transcription of purified RNA was performed using random hexamers primers and Superscript III reverse transcriptase according to the manufacturer’s instructions (Invitrogen). Quantitative RT-PCR was performed with the TaKaRa SYBR Premix Ex Taq kit on the ABI-QuantStudio 6 Realtime PCR system.
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was synthesized using oligo-dT and random hexamer primers according to the SYBR Green qPCR protocol (Life Technologies). Total RNA was reverse transcribed using High Capacity Reverse Transcriptase kits (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Capillary sequencing was performed using forward and reverse primers with the BIG dye terminator chemistry v3.1 (Applied Biosystems, UK), according to the protocol adopted from CDC in Atlanta ...
-
bioRxiv - Neuroscience 2024Quote: ... The ssDNA primers to generate the shRNAs were either obtained using the Block-it RNAi web tool (Thermo Scientific) or designed by hand and were as follows:
-
bioRxiv - Neuroscience 2024Quote: ... Heterozygous NEK1 nonsense mutation was assessed by Sanger sequencing using specific primers (FOR_TATTTTCCTGATATGTGGGTTTT and REV_TGGATGTGTGTTTGTGTCTGT) and the amplicon was sequenced on an ABI 3500 Genetic Analyzer (Applied Biosystems). Q-banding was used for cytogenetic analysis of the iPSC line as already described (Santangelo et al. ...
-
bioRxiv - Genomics 2024Quote: ... These primers were adapted to include the necessary attB Gateway recombination elements for integration into pDONR P2r-P3 (Invitrogen). The N2 RNA was reverse transcribed using Superscript III Reverse Transcriptase and poly-dT primers under the recommended conditions (Invitrogen) ...