Labshake search
Citations for Thermo Fisher :
9101 - 9150 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... RNAs were subjected to reverse transcription using the Invitrogen SuperScript IV VILO Master Mix RT kit (Life Technologies). Real-time PCR was performed using the Applied Biosystems SYBR green Master mix (Life Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... Full-length 5’ RACE was performed using the GeneRacer™ with Superscript™ III RT kit (ThermoFisher Scientific) as described in the manual with modifications adapted from the methods of Stadelmeyer et al.17 The 5’RACE PCR was ran using the Platinum™ SuperFiTM DNA Polymerase (ThermoFisher Scientific) ...
-
bioRxiv - Plant Biology 2020Quote: ... with the attB primers listed in Supplemental Table 3 and cloned into the Gateway vector pDONR207 (Thermo Fisher Scientific) using the Gateway BP clonase II enzyme mix (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Reactions were run using primer/probes at 1:20 dilution and Taqman FastVirus one-step reaction mix (Thermo Scientific), and amplified using an Applied Biosystems QS3 cycler ...
-
bioRxiv - Developmental Biology 2021Quote: ... for gene expression quantification using gene specific primer pairs (Table 1) and SYBR Green master-mix (Applied Biosystems, UK). The standard thermal cycling protocol was conducted as follows ...
-
bioRxiv - Genetics 2021Quote: ... For cDNA synthesis 5 μg of total DNase-treated RNA was reverse transcribed with 1 μL of oligo-(dT)20 primers (50 μM) and 0.25 μL of SuperscriptIII (Invitrogen) according to the manufacturer instructions.
-
bioRxiv - Immunology 2021Quote: ... All subsequent RNA was used for reverse transcription using random hexamer and oligo dT primers with SuperScriptll (ThermoFisher, 18064022). cDNA was diluted 1:5 and gene expression quantitated by real-time PCR using SYBR Green incorporation on a Bio-Rad iCycler ...
-
bioRxiv - Microbiology 2020Quote: ... vif vpr and vpx coding sequences were amplified with specific primers from pKP59-HIV-2 ROD plasmid and cloned into pcDNA3.1 vector (Invitrogen). Expression vectors encoding the six different mutants of HIV-2 Env cytoplasmic tail were created by introducing stop codon in different position within the cytoplasmic tail by site-directed mutagenesis using the QuickChange II Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Developmental Biology 2021Quote: ... total RNA was reverse transcribed using random primers and High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Waltham, MA). Quantitative PCR (QuantStudio 6 ...
-
bioRxiv - Genomics 2022Quote: ... qPCR was performed with gene-specific primer probe fluorogenic exonuclease assays (TaqMan, Life Technologies, Waltham, MA, Supplemental table 5) and the QuantStudio 12K Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was reverse transcribed using random oligo-dT primers with a Verso cDNA synthesis kit (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription and strand-switching were performed by first adding 2.5 μl VNP primer and 1 μl 10mM dNTPs (ThermoFisher) to each mRNA sample and incubating at 65°C for 5 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was made from 1 µg of total RNA with random hexamer primers and MultiScribe reverse transcriptase (Applied Biosystems), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... mRNA was reverse- transcribed using the SuperScript IV First-Strand Synthesis System and Oligo-dT primers (Thermo Fisher Scientific) and was amplified in a thermal cycler using the PowerUP SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: Reverse transcription was performed using the SuperScript IV First-Strand Synthesis System and Oligo-dT primers (Thermo Fisher Scientific). The qPCR was performed using the TaqMan Fast Universal PCR Master Mix (Thermo Fisher Scientific ...
-
The G2-phase enriched lncRNA SNHG26 is necessary for proper cell cycle progression and proliferationbioRxiv - Molecular Biology 2021Quote: ... We added 2 μl ChIP DNA and 500 nM of each primer to SYBR Select Master Mix (Applied Biosystems) in three technical replicates ...
-
bioRxiv - Molecular Biology 2021Quote: ... We added 2 μl ChIP DNA and 500 nM of each primer to SYBR Select Master Mix (Applied Biosystems) in technical duplicates ...
-
bioRxiv - Cell Biology 2022Quote: ... The oligonucleotide sequences for the genes measured in this study were designed using the Primer Express program (Applied Biosystems) and are available upon request ...
-
bioRxiv - Genomics 2020Quote: Assembled viral sequences from the appropriate sample were imported into Primer ExpressTM v3.0.1 software (Thermo Fisher Scientific, Waltham, MA) where qPCR Taqman assays were designed using default parameters ...
-
bioRxiv - Cell Biology 2019Quote: Total RNA was isolated from lung tissue was reverse-transcribed with oligo(dt) primers and SuperScript reverse transcriptase (Invitrogen). The cDNA obtained was mixed with SYBR Green PCR mix (AB Applied Biosystems) ...
-
bioRxiv - Genomics 2019Quote: ... The DNA primer was modified to include the attB Gateway recombination elements required for insertion into pDONR P2RP3 (Invitrogen). The reverse DNA primers were designed to end between 200 and 250 nucleotides downstream of the RNA cleavage site and to include the reverse recombination element attB for cloning into pDONR P2RP3 (Invitrogen) ...
-
bioRxiv - Genomics 2019Quote: ... 200 nM of each primer and 10 μl of Fast SYBR Green master mix (Life Technologies, Grand Island, NY) were used ...
-
bioRxiv - Cell Biology 2019Quote: ... Total RNA was reverse transcribed with random hexamer primers using the Superscript II Reverse Transcriptase kit (ThermoFisher, 18064-022). qPCR was performed with SYBR Green PCR Master Mix (ThermoFisher ...
-
bioRxiv - Genomics 2020Quote: ... four pairs of validated primers (Våge & Boman 2010) were mixed with cDNA and AmpliTaq Gold® Polymerase (Applied Biosystems) in four separate PCR reactions generating overlapping regions of the BCO2 cDNA [13] ...
-
bioRxiv - Physiology 2020Quote: ... with the primers listed in Table 1 (500 nM of each) in a SmplyAmp™ Thermal Cycler (Applied Biosystems). All primers were purchased from Sigma-Aldrich.
-
bioRxiv - Microbiology 2019Quote: The primer extension assay was applied to the RNA samples by using Superscript IV reverse transcriptase (Thermo Fisher Scientific). The reaction volume was set to 10 μL ...
-
bioRxiv - Immunology 2019Quote: ... Primer pairs (Table S12) were designed using Primer Premier Software 5.0 (Premier Biosoft International, Palo Alto, CA) and synthesized by Invitrogen. Quantitative real-time PCR was performed in triplicate wells of a 96-well reaction plate on an ABI 7500 PCR System (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2µL of PCR products using a tagged forward primer were combined with 11.7µL formamide and 0.3µL of Genescan™ LIZ® 500 size standard (Applied Biosystems) and genotyped on an ABI 3739xl (Applied Biosystems) ...
-
bioRxiv - Genetics 2019Quote: ... cDNAs were generated from 1µg of purified RNA with oligo (dT) primers using the SuperScriptTM II Reverse Trancriptase kit (Invitrogen).
-
bioRxiv - Developmental Biology 2019Quote: ... 0.25 μM gene-specific primers (Extended Data Table 2) and 1 x Power SYBR Green Master Mix (ThermoFisher Scientific) in a StepOne Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2020Quote: ... combined with Oligo-dT primers for first-strand synthesis (High Capacity cDNA reverse transcription kit (ThermoFisher Scientific, Carlbad, CA). These reactions synthesized T7-tagged positive-sense and GVA-tagged negative-sense viral cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... Purified RNAs were reverse transcribed by random hexamer primers using a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems), according to the manufacturer instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Levels of protrudin mRNA were analysed using pre-validated primer sequences (rat Protrudin, RN01766356_m1; cat no. 4331182; ThermoFisher Scientific). Q-PCR was performed on a LighCycler Q-PCR machine (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was primed with 10-mer random primers and reverse transcription was catalyzed using Superscript II reverse transcriptase (Invitrogen) to generate cDNAs ...
-
bioRxiv - Neuroscience 2019Quote: ... qPCR was performed with gene-specific primer probe fluorogenic exonuclease assays (TaqMan, Life Technologies, Waltham, MA, Supplemental table 3) and the QuantStudio™ 12K Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... SALK_015201 and irr-2 genomic DNA using gene specific primers (Supplemental Table 2) with Phusion polymerase (Thermo Fisher Scientific) and cleaned up using the Gene-JET PCR Purification Kit from Thermofisher (catalog number K0701) ...
-
bioRxiv - Microbiology 2021Quote: ... using Lav_F (FAM-GCCCCATTTATTTTTACTTGACAAAGG) and Lav_R (GCTCATTTGTTAATTTAGAATTGTCATAAG) primers by sizing and quantifying using the GeneScan system (Applied Biosystems International) at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RNA was converted into cDNA using random hexamers as primers provided with the cDNA synthesis kit (Thermo Scientific, USA). cDNA was further subjected to quantitative real time PCR in CFX96 real-time system (Bio Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA and primers were used in a 20 μl qPCR reaction with PowerUp SYBR Green Master Mix (Applied Biosystems), following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... The viral RNA from patient samples were reverse transcribed with the primer DENV-CRP with the Superscript IV reverse transcriptase according to manufacturer’s instruction (Invitrogen). All template nucleic acids were quantified using Qubit-4 fluorometer when not mentioned otherwise.
-
bioRxiv - Genetics 2022Quote: ... First strand cDNA synthesis was performed using the logo (dT)18 primer and RevertAid Reverse Transcriptase (Thermo Scientific™) according to the protocol provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µl of 2 µM Uni9 primer and 1µl of 10 mM dNTP (Thermo Scientific™, Cat no. # R0181) were mixed and warmed at 65 ºC for 5 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... qPCR was performed on lysates with 0.5 μL each of 20 μM forward and reverse primers 0.5-2 μL of sample and 6.25 μL PowerUp SYBR Green Master Mix (Applied Biosystems) with a total reaction volume of 12.5 μL using a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Immunology 2022Quote: ... This master mix was added to premade 96 well TaqMan Array plates with chemokine/chemokine receptor primers (Thermo Fisher, Mouse Chemokines & Receptors Array plate ...
-
bioRxiv - Genomics 2022Quote: ... For reverse transcription cDNA was synthesised from 0.5μg of RNA using SuperScript™ III Reverse Transcriptase and random primers (both Invitrogen) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... reverse transcription was performed on the isolated RNA using random hexamer primers and TaqMan reverse transcriptase (Thermo-Fisher Scientific). cDNA was subjected to qPCR with specific primers for IFIT1 ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA preparation was done using the SuperScript™ IV First-Strand Synthesis System with oligo-dT primers (#15327696, Invitrogen). RT-qPCR was performed using TaqMan™ Fast Advanced Master Mix (#4444557 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 250 ng of each sample were reverse transcribed using the Superscript III enzyme and random primers (Life Technologies).
-
bioRxiv - Molecular Biology 2020Quote: ... 3 μl of cDNA was added to 10 μl qPCR reactions containing 0.5 μM forward and reverse primers as well as 1X PowerUP SYBR green master mix (ThermoFisher) in 384-well plates ...
-
bioRxiv - Microbiology 2021Quote: ... 6.25 µl of 4 μM primers P1 and P2 and 1 µl of template DNA (Thermo Scientific, cat#F553S), and milliQ water up to 50 μl ...