Labshake search
Citations for Thermo Fisher :
9301 - 9350 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: ... simulans mh genomic region covering the coding region and ~3000 bp upstream was PCR amplified from the strain w501 using oligos 2099/2100 and cloned into pCR-Blunt II-TOPO (Invitrogen). The sequence of sim-mh was confirmed by Sanger sequencing (using oligos 788 ...
-
bioRxiv - Neuroscience 2022Quote: Using a subcloned and sequenced PCR fragment (162 bp – Table S1) of the mouse 5-HT2AR cDNA (Zero Blunt TOPO PCR Cloning kit, Invitrogen), high specific-activity RNA probes were produced from a linearized plasmid (HindIII ...
-
bioRxiv - Physiology 2022Quote: ... Real-time PCR reactions (qPCR) were performed in triplicate using the Power SYBR Green PCR Master Mix Kit (Thermo Fisher) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... The real-time quantitative PCR (qRT-PCR) was performed with TaqMan Fast Advanced Master mix (ThermoFisher Scientific, catalog n°4444963) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... The DNA linkers produced by the PCR reaction were first desalted using an amicon centrifugal filter and purified using the PureLink PCR purification kit (Thermofisher). DNA linkers were eluted with low TE buffer (10 mM Tris-HCl ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Quantitative real-time PCR (qRT-PCR) was performed in an ABI StepOnePlus instrument with the SYBR green detection system (Invitrogen). PCR thermal profiles were 40 cycles with 10 s at 95 °C and 30 s at 60 °C each cycle ...
-
bioRxiv - Biochemistry 2022Quote: The two PCR products were linked after NOT1 digestion and the final fusion PCR product was cloned into the pCDH-puro (InvitroGen) expression vector.
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PCR reactions employing SYBR Green were run on a 7900HT Fast Real-Time PCR System (Applied Biosystems). PCR primers for Xbpls ...
-
bioRxiv - Developmental Biology 2021Quote: PCR products were cloned using the TOPO™ TA Cloning™ Kit with pCR™2.1-TOPO™ (Thermo Fisher) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: RT-qPCR was carried out on the Applied Biosystems 7500 Real Time PCR system using Power SYBRgreen PCR master mix (Invitrogen), 2 ng of cDNA per reaction and the following cycling conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... RealTime PCR was performed on a 7900HT Fast Real-Time PCR System with TaqMan® Array Block (Thermo Fisher Scientific), using universal cycling conditions (95 °C/10 min ...
-
bioRxiv - Microbiology 2021Quote: ... The number of PCR cycles for sufficient DNA for downstream applications was empirically determined by quantitative PCR (ViiA 7 Real-Time PCR System, ThermoFisher) in the presence of 1X Evagreen (20X Evagreen ...
-
bioRxiv - Neuroscience 2020Quote: The UAS-konICD-HA construct was generated from EST LD31354 via PCR amplification with Kappa HiFi PCR kit (Peqlab) and subsequent cloning using the Gateway cloning system (Invitrogen) according to manufacturers instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR was performed using PowerUP SYBR Green master mix on an ABI StepOnePlus real-time PCR instrument (Applied Biosystems). All PCR reactions were run in triplicates ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Real-time PCR was performed using the Power SYBR green PCR master mix in an ABI Prism 7900 (Applied Biosystems). The RNA probes used for the detection of endogenous tpm1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Real-time quantitative PCR was performed on a ViiA 7 Real-Time PCR System with OptiFlex Optics System (Applied Biosystems) using PowerUp SYBR Green PCR kit (Applied Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: ... qRT-PCR was performed using the qPCRBio SyGreen Mix Hi-ROX (PCR biosystems) according to the manufacturer’s instructions and run on the Real Time PCR QuantStudio3 (ThermoFisher scientific) using the following conditions – Initial denaturation step at 95□ °C for 2 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... Real Time PCR was performed in a total reaction volume of 25 μL using the SYBRTM Green PCR Master Mix (ThermoFisher).
-
bioRxiv - Microbiology 2022Quote: ... 2 × PCR master mix (Invitrogen™ Platinum™ Hot Start PCR 2X Master Mix, Thermo Fisher Scientific, Waltham, MA, USA), forward and reverse primers (200 nM each) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and ran on QuantStudioTM 6 Flex Real-Time PCR System using QuantStudioTM 6 and 7 Flex Real-Time PCR software v1.0 (Applied Biosystems). Relative gene expression levels were quantified using β-actin or human TBP as housekeeping genes ...
-
bioRxiv - Genomics 2019Quote: ... The qRT-PCR was conducted by an Applied Biosystems 7500 Real Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) and SYBR Premix Ex Taq™ II (TaKaRa ...
-
bioRxiv - Biochemistry 2019Quote: ... Real-time PCR was performed on a Step-One Plus Real-Time PCR Detection System (Applied Biosystems, Waltham, MA, USA) using 2X Power SYBR Green Mastermix (ABI ...
-
bioRxiv - Plant Biology 2019Quote: ... The HaLBD16 was amplified by PCR using Invitrogen™ Platinum™ SuperFi™ Green PCR Master Mix (Thermo Fisher Scientific) with Gateway primers (HA LBD16-B1 5’ ggggacaagtttgtacaaaaaagcaggctatggcaactgttgctgctgg 3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... the PCR reaction was digested by a combination of restriction enzymes directly added to PCR reaction (37uL H2O, 10 uL ThermoFisher FD Buffer ...
-
bioRxiv - Microbiology 2019Quote: ... qRT-PCR was conducted using the Applied Biosystems One-Step Real-time PCR protocol using SYBR Green fluorescence (Applied Biosystems) on an Applied Biosystems 7900HT real-time PCR machine in 96-well-plate format ...
-
bioRxiv - Cancer Biology 2020Quote: ... Real-time PCR was performed on an ABI PRISM 7900HT or QuantStudio 7 Flex Real-Time PCR System (Life Technologies) with Power SYBR Green PCR Mix (Life Technologies) ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR was performed in triplicate to amplify 16s rDNA using DreamTaq Green PCR Master Mix (K1081, Thermo Fisher Scientific Inc.) with primers F8 (5’-AGTTTGATCCTGGCTCAG-3’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products across the genomic sequence were amplified and then cloned with the Zero Blunt TOPO PCR Cloning Kit (Invitrogen), and then transformed into E ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Amplicons exceeding the estimated minimum were gel purified as described above and cloned into the pCR Blunt II-TOPO vector using the Zero Blunt TOPO PCR Cloning Kit (Invitrogen). Ligated plasmids were transformed into One Shot TOP10 Chemically Competent E ...
-
bioRxiv - Cancer Biology 2020Quote: ... All qRT-PCR measurements were obtained in a 7900HT Fast Real Time PCR System with ExpressionSuite Software v1.0 (Applied Biosystems). Taqman probes utilized in this study are listed in S-Table 9.
-
bioRxiv - Plant Biology 2021Quote: ... qPCR was performed on a StepONE Plus Real-Time PCR system with Fast SYBR-Green PCR master mix (Applied Biosystems). FLC primer sequences were as previously described (Csorba et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... the PCR products from using the primer OT-F and OT-R1 were subcloned into the pCR Blunt II TOPO vector (Zero Blunt TOPO PCR Cloning Kit, ThermoFisher) and sequenced using M13-Foward and M13-Reverse primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Real-time PCR was performed on a 7500 or Q7 real-time PCR system (Applied Biosystems, Foster City, CA, USA) using SYBR Premix Ex Taq with ROX (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The PCR products were purified by PCR-clean up (AxyPrep PCR Cleanup Kit, Axygen) and then self-circularized via T4 Polynucleotide Kinase (ThermoFisher), ATP (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a 7900HT Fast Real-Time PCR System or a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). The mRNA expression levels were calculated with the 2-ΔΔCt method ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative real-time PCR reactions employing SYBR Green were run in a 7900HT Fast Real-Time PCR System (Applied Biosystems). The following primers were used ...
-
bioRxiv - Developmental Biology 2020Quote: ... qRT-PCR reactions were performed using SYBR Green Master Mix in a 7500 Fast Real Time PCR cycler (Applied Biosystems). The TATA-box-binding protein domain gene was used as the internal control ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time PCR was performed and analysed using the ABI ViiA™ 7 real time PCR system (Thermo Fisher Scientific). TaqMan Gene Expression Assays (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 1 µl of a 1:50 dilution of the first PCR product and 0.4 µl Long PCR Enzyme Mix (ThermoFisher Scientific). The PCR program was the same as for the first PCR ...
-
bioRxiv - Genomics 2019Quote: ... A real-time PCR was performed using the QuantStudio 6 Flex Real-Time PCR System (# 4485694, Applied Biosystems, CA, USA) with the following reagents ...
-
bioRxiv - Immunology 2019Quote: ... the generated cDNA was subjected to a first round of PCR using Platinum SuperFi PCR Master Mix (Life Technologies; 12358250) to amplify a 3 kb region spanning gag-pol using primers Pan-HIV-1_2F ...
-
bioRxiv - Cancer Biology 2019Quote: ... Fast SYBR™ Green quantitative PCR was performed on a Step One™ Plus Real-Time PCR System (Applied Biosystems). Sequence of all RT-qPCR primers are shown in Supplementary Table 1.
-
bioRxiv - Cell Biology 2021Quote: ... one-step quantitative real-time PCR was performed using the SuperScript III Platinum SYBR Green One-Step qRT–PCR Kit (Invitrogen) with primers specific for TRS (listed above ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR products were subcloned into pCR™2.1-TOPO® TA vectors using TOPO TA Cloning Kit (Thermo Fisher scientific) and sequenced for verification of correct amplification.
-
bioRxiv - Microbiology 2021Quote: ... All PCR reactions were performed using the Phusion Green Hot Start II High-Fidelity PCR Master Mix (Fisher Scientific, F566S). For reactions where gel extraction was necessary ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed in 27 μl reactions with 22.5 μl of Invitrogen Platinum PCR SuperMix (Thermo Fisher, Carlsbad, CA, USA), 1.0 μl of forward and reverse primers (10 μM) ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... mRNA expression levels were determined by real-time PCR using SYBR™ Green PCR Master Mix (Life Technologies, California, USA) on an ABI 7500 system ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative real-time PCR was run on the Applied Biosystems7500 Real Time PCR System (Applied Biosystems, Foster City, CA, USA) by following the 2 steps real time RT-PCR procedure and using primers listed in Table 1 ...
-
bioRxiv - Pathology 2021Quote: ... Real-time PCR assays were run on an ABI Prism One step real-time PCR machine (Applied Biosystems, Courtaboeuf, France). Normalization was performed using 36B4 as a reference gene ...
-
bioRxiv - Cell Biology 2021Quote: ... Full length cDNA clones were obtained using primer specific to the 3’ end of dPIP5KL and then cloned into an intermediate vector: pCR-XL-TOPO (TOPO XL PCR Cloning Kit, Invitrogen) and finally subcloned into fly expression vector pUAST-attB using Not1 and Xho1 restriction sites ...