Labshake search
Citations for Thermo Fisher :
9251 - 9300 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Both PCR products were subcloned into Blunt-TOPO vector using Zero Blunt TOPO PCR Cloning Kit (Invitrogen, cat. K2800-20SC) and verified by Sanger sequencing ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We determined indexing PCR cycle number for each library with quantitative PCR (qPCR) on a Stratagene Mx3000P thermocycler (Applied Biosystems) using a DyNAmo Flash SYBR Green qPCR kit (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative real-time PCR was performed using a Step One Real-Time PCR System Thermal Cycling Block (#4376357; Applied Biosystems) and a Maxima SYBR Green/ROX qPCR Master Mix 2x (#K0222 ...
-
bioRxiv - Genomics 2020Quote: ... Quantitative real-time PCR (qRT-PCR) was carried out on ABI7900 with PowerUp SYBR Green Master Mix kit (Applied Biosystems), according to the recommendations of the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were size confirmed on a 0.1% agarose gel and then sequence confirmed (Eurofins Scientific) after PCR clean up (ChargeSwitch PCR Clean-Up Kit (ThermoFisher Scientific)).
-
bioRxiv - Molecular Biology 2020Quote: ... Taqman based qRT-PCR was performed using the one step Affymetrix HotStart-IT qRT-PCR Master Mix Kit (Affymetrix USB) and 50 ng of total RNA per reaction ...
-
bioRxiv - Molecular Biology 2021Quote: ... were used for each luciferase and two reference genes were also quantified with qRT-PCR using an ABI QuantStudio 5 Real-Time PCR System (ThermoFisher). Three technical replicate reactions were performed for each unique primer set for each sample.
-
bioRxiv - Molecular Biology 2020Quote: ... Target genes in input total RNA and enriched RNA were quantified by qRT-PCR using SuperScript III Platinum One-Step qRT-PCR Kit (Invitrogen). Control group with untransfected HEK cells was processed with the same protocol in parallel.
-
bioRxiv - Molecular Biology 2020Quote: ... Target genes in input total RNA and enriched RNA were quantified by qRT-PCR using SuperScript III Platinum One-Step qRT-PCR Kit (Invitrogen).
-
bioRxiv - Genomics 2020Quote: Gene fragments (gBlocks) were cloned into pCR-Blunt II-TOPO vector using the Zero Blunt TOPO PCR Cloning kit (Invitrogen) and their sequences were verified by Sanger sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... enabled us to perform quantitative PCR on an Applied Biosystems 7500 Fast Real-Time PCR System (Applied Biosystems, CA, USA) using the manufacturer’s instructions for a standard cycling protocol ...
-
bioRxiv - Genomics 2019Quote: ... Quantitative real-time PCR was performed in three technical replicates on the ABI-7900HT Real-Time PCR System (Applied Biosystems) using the PowerUp SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... were performed in an Applied Biosystems real-time PCR detection system using Superscript III platinum-SYBR green one-step qRT-PCR kit (Invitrogen) and cycling conditions as described (28) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We determined indexing PCR cycle number for each library with quantitative PCR (qPCR) on a Stratagene Mx3000P thermocycler (Applied Biosystems) using a DyNAmo Flash SYBR Green qPCR kit (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... PCR reaction mix of 20 μL of TaqMan 2X Advanced Fast PCR MasterMix (Applied Biosystems Inc., Foster City, CA, USA), 1 μL of CISH TaqMan Gene Expression Assay (Applied Biosystems) ...
-
bioRxiv - Genetics 2020Quote: ... PCR was performed in a 25 μl reaction volume using 12.5 μl PCR Master mix 2x Kit (Thermo Fisher Scientific), 60-80 ng DNA ...
-
bioRxiv - Physiology 2019Quote: ... and 300nM of forward and reverse primer in a 25µl Power SYBR Green PCR Master Mix reaction in the StepOne-Plus Real-Time PCR System (Applied Biosystems). Gene expression was normalized to mouse RPS29 gene expression ...
-
bioRxiv - Genetics 2019Quote: ... qPCRs were performed with a 7500 real-time PCR amplification system using SYBR Green PCR master mix (Applied Biosystems, UK). The relative levels of transcripts were calculated using the ΔΔCT method within the ABI 7500 System Software (V2.0.4) ...
-
bioRxiv - Microbiology 2019Quote: ... This plasmid was then used as a PCR template to generate the fragment hns-mEos3.2-cat by PCR using Phusion High-Fidelity DNA Polymerase (Thermo Fisher) and primers SB039 (5’ - GCCGCTGGCGGGATTTTAAGCAAGTGCAATCTACAAAAGAGCTCTTTTTTGTGC GGTGCC ...
-
bioRxiv - Biochemistry 2019Quote: ... following the manufacturer’s instructions and qRT-PCR was performed with a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) using PerfeCTa SYBR Green SuperMix ...
-
bioRxiv - Genetics 2019Quote: ... The fused products were then subcloned into the pCR-Blunt vector using a Zero Blunt PCR Cloning Kit from ThermoFisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl PCR reaction were directly taken for TOPO cloning with Zero Blunt™ TOPO™ PCR Cloning Kit (Invitrogen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... The PCR products were sequence-verified using TA cloning in pCR™4Blunt-TOPO® Vector (Invitrogen cat # K2875-20). M13F and M13R vector primers were used for sequencing (Molecular Cloning Facility ...
-
bioRxiv - Developmental Biology 2019Quote: Real-time qPCR was performed using Power SYBR PCR master mix with ABI 7900 Real-Time PCR system (Applied Biosystems). All oligonucleotide primers used in this project were designed against two exons flanking an intron to avoid amplification of genomic DNA (Supplementary Table 1) ...
-
bioRxiv - Plant Biology 2019Quote: ... Real-time quantitative PCRs were performed in the presence of Power SYBR green PCR Master Mix (Applied Biosystems, Guangzhou, China). Amplification was monitored in real-time with the MiniOpticon™ Real-Time PCR System (Bio-Rad ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The first PCR was carried out in 25-µl PCR reactions and comprised 0.02 U µl−1 Phusion polymerase (ThermoFisher, USA), 0.2 mM dNTP ...
-
bioRxiv - Genomics 2021Quote: ... Ten cycles of PCR amplification were completed on a GeneAmp PCR System 9700 thermal cycler (Applied Biosystems, Foster City, CA) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR was performed by using the QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific, USA) with cDNA as the template ...
-
Dual signaling via interferon and DNA damage response elicits entrapment by giant PML nuclear bodiesbioRxiv - Microbiology 2021Quote: ... Real-time PCR was conducted using an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) as described previously or an Agilent AriaMx Real-time PCR System with the corresponding software AriaMx 1.5 (Agilent Technologies ...
-
bioRxiv - Genetics 2021Quote: ... by using PCR stitching to create an enhancer reporter which was sequence verified and purified with a PureLink PCR purification kit (ThermoFisher) for injection ...
-
bioRxiv - Microbiology 2021Quote: ... one-step quantitative real-time PCR was performed using SuperScript III Platinum SYBR Green One-Step qRT-PCR Kit (Invitrogen) with primers specific for the TRS-L and TRS-B sites for the N gene as well as ACTB as an internal reference ...
-
bioRxiv - Microbiology 2020Quote: ... One-step qRT-PCR was performed using the Invitrogen EXPRESS One-Step Superscript qRT-PCR kit (Thermo Fisher Cat #11781200) and the commercial Taqman probe ACE2 (Hs01085333_m1) ...
-
bioRxiv - Neuroscience 2020Quote: ... mRNA expression levels were assessed by quantitative real-time PCR using SYBR Green dye-based PCR amplification (Thermo Fisher Scientific) and the QuantStudio 3 detection system (Applied biosystems) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Bi-allelically targeted clones were selected and the PCR products were cloned into the PCR-4 TOPO TA vector (Invitrogen) and sequenced to select clones heterozygous the NRASG12D mutation.
-
bioRxiv - Cancer Biology 2020Quote: ... Mono-allelically targeted clones were selected and the PCR products were cloned into the PCR-4 TOPO TA vector (Invitrogen) and sequenced ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR fragments were purified by QIAquick PCR purification kit and sequenced with an ABI Genetic analyzer 3500 (Applied Biosystems).
-
bioRxiv - Plant Biology 2021Quote: ... PCR reactions used PerfeCTa® SYBR® Green FastMix® (Quantabio) on a StepONE-Plus quantitative PCR system (Applied Biosystems) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PCR was performed using the StepOne™ Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). Reactions included a mixture of 5 µl 2X SYBR ...
-
bioRxiv - Neuroscience 2020Quote: ... and SYBR Green PCR reagents according to the manufacturer’s instructions on a StepOnePlusTM Real Time PCR System (Thermo Fisher Scientific). The primers used are listed in Table S2 ...
-
bioRxiv - Microbiology 2021Quote: ... The only difference between the two protocols was the Taq used for PCR: EMP used Platinum Hot Start PCR MasterMix (Thermofisher) and in-house used Accustart™ II PCR ToughMix (QuantaBio) ...
-
bioRxiv - Microbiology 2020Quote: ... one-step quantitative real-time PCR was performed using SuperScript III Platinum SYBR Green One-Step qRT-PCR Kit (Invitrogen) with primers specific for the TRS-L and TRS-B sites for the N gene as well as ACTB as an internal reference ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR (qPCR) was performed using THUNDERBIRD SYBR qPCR Mix (TOYOBO) and Step One Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Cancer Biology 2020Quote: PCR amplification was performed in technical triplicates on the Applied Biosystems QuantStudio 3 Real-Time PCR System (Applied Biosystems-ThermoFisher). The PCR reaction contained SimpleChip Universal master mix (catalogue # 88989 ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR amplification was performed in technical triplicates on the Applied Biosystems QuantStudio 3 Real-Time PCR System (Applied Biosystems-ThermoFisher). TaqMan Universal PCR Master Mix (Applied Biosystems-ThermoFisher ...
-
bioRxiv - Cancer Biology 2020Quote: PCR amplification was performed in technical triplicates on the Applied Biosystems QuantStudio 3 Real-Time PCR System (Applied Biosystems-ThermoFisher). The PCR reaction contained SimpleChip Universal master mix (catalogue # 88989 ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR amplification was performed in technical triplicates on the Applied Biosystems QuantStudio 3 Real-Time PCR System (Applied Biosystems-ThermoFisher). TaqMan Universal PCR Master Mix (Applied Biosystems-ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... The fragments were cloned into pCR-Blunt II TOPO using the Zero Blunt TOPO PCR Cloning Kit (Thermo Fisher Scientific), and the sequencing was verified using M13 forward and M13 reverse universal primers ...
-
bioRxiv - Cell Biology 2020Quote: ... Real-time PCR was performed in a 7500 Fast Real-Time PCR System using Taman probes (Life Technologies Ltd, UK) GAPDH (Mm99999915_g1) ...
-
bioRxiv - Cell Biology 2021Quote: ... Transcript abundance was quantified on a QuantStudio 6 Real Time PCR system using SYBR® Green PCR Master Mix (ThermoFisher) and gene-specific primers (Supplementary Table S5) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR reaction procedure was carried out on the ABI 7900HT Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA) with the AceQ qPCR SYBR Green Master Mix (Vazyme ...