Labshake search
Citations for Thermo Fisher :
9201 - 9250 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... 5 μg of DNase-treated RNA was converted into cDNA by reverse transcription using oligo(dT)20 primer (50 μM) and 0.25 μL of superscript IV (Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... RNA (2 μg) was reverse transcribed using random primers with a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). Quantitative PCR was performed in triplicate using the SYBR Green method (Life Technologies) ...
-
bioRxiv - Genetics 2023Quote: ... DNase-treated RNA was reverse transcribed with random primers using the high-capacity cDNA synthesis kit (Thermo Fisher 4368814). Target gene expression was monitored by quantitative PCR and normalized to Gapdh and Eef2a levels with gene-specific primers (oligonucleotide sequences provided in Supplemental Table S17) ...
-
bioRxiv - Genetics 2023Quote: ... Total RNA (2500ng) was reverse transcribed using SuperScript® II Reverse Transcriptase with oligo(dT) primers (Thermo Fisher Scientific) in a 20uL volume according to the manufacturer’s instructions with the exception that the synthesis incubation period at 42°C was increased from 50 to 60min ...
-
bioRxiv - Immunology 2023Quote: cDNA was synthetized using the RevertAid First Strand cDNA Synthesis Kit and random hexamer primers (Thermo Fisher Scientific #K1622) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were reverse-transcribed using random primers and the High Capacity cDNA Reverse Transcription Kit (ThermoFisher/Applied Biosystems, # 4368814). Quantitative PCR was performed in technical triplicates from at least 3 independent biological samples using the SYBR green Brilliant II fast kit (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were reverse-transcribed using random primers and the High Capacity cDNA Reverse Transcription Kit (ThermoFisher/Applied Biosystems, # 4368814). Quantitative PCR was performed in technical triplicates from at least 3 independent biological samples using the SYBR green Brilliant II fast kit (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was made using 0.5 μg total RNA with oligo-dT primer and Verso cDNA Synthesis Kit (Thermo Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... Each reaction contained 0.5 μM of each forward and reverse primer (Integrated DNA Technologies) and 1× SYBR Green (Invitrogen). Thermal cycling consisted of an initial denaturation for 10 min at 95 °C followed by 40 cycles of 95 °C for 15 s ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... gene specific forward and reverse primers (0.5 µM final concentration) and 0.025 % DMSO were added along with DreamTaq DNA polymerase (Thermo scientific), reaction buffer and dNTPs ...
-
bioRxiv - Cell Biology 2023Quote: ... Gene specific primers (IDT, IN) and the template cDNA were added to Power SYBR Green master mix (Applied Biosystems). Primer sets were designed and by IDT ...
-
bioRxiv - Plant Biology 2023Quote: ... 200 ng of total RNA was used for cDNA synthesis with an oligo(dT)18 primer and SuperScriptIII (Invitrogen) reverse transcriptase ...
-
bioRxiv - Genomics 2023Quote: ... qPCR was performed with gene-specific primer probe fluorogenic exonuclease assays (TaqMan, Life Technologies, Waltham, MA, Additional file 1B) and the QuantStudio™ 12K Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 μg of total RNA was reverse transcribed using random primers with M-MLC reverse transcriptase (Invitrogen, cat#28025021). Real-time PCR was conducted on Roche Lightcycler 96 Real time PCR system (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg total RNA was reversely transcribed by incubation with random primers (100 pmol μL−1, Invitrogen, Carlsbad, USA) and M-MuLV reverse transcriptase enzyme (200,000 U mL−1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... TBP mRNA was determined by using a predeveloped assay reagent while primers and TaqMan probe were designed for detecting AMPKγ3 mRNA using the database www.ensembl.org and Primer Express 3.0 software (Applied Biosystems, CA, USA). Both real-time PCR reactions were performed using Universal MasterMix and TaqMan MGB probes with 5’FAM and a 3’ nonfluorescent quencher (NFQ ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers to amplify the splicing isoforms of interest were used with Promega Go Taq polymerase (Thermo Fisher Scientific; PRM7123). For RT-PCR analysis of Dual-IN and Dual-EX splicing reporters ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR was performed with gene-specific primer probe fluorogenic exonuclease assays (TaqMan, Life Technologies, Waltham, MA, Supplemental Table 2) on a QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.75 µL of 20 µM P3/P6 tall primer mix and 0.25 µL of 25X Sybr Green (ThermoFisher #S7563). Libraries were amplified for 8-12 cycles as determined by RT-qPCR on a QuantStudio3 RT-qPCR thermal cycler ...
-
bioRxiv - Molecular Biology 2023Quote: ... were obtained by PCR using the appropriate cDNA clone and gene-specific primers flanked by attB sites followed by BP-mediated GATEWAY recombination into pDONR221 according to manufacturer’s instructions (Invitrogen). The cloned sequence was verified by sequencing and it was transferred to the pcDNA5-FRT-TO-N-GFP Gateway destination vector by LR recombination according to the manufacturer’s protocol (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... total RNA was reverse transcribed into cDNA using random hexamer primers and SuperScript III first-strand synthesis kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... supplied with the primers for ICP27 and β-actin on a Quant Studio 6 Flex qPCR system (Applied Biosystems).
-
bioRxiv - Cancer Biology 2023Quote: ... analysis was performed using TaqMan gene expression assay with ST2 and IL-1RAcP specific primers (Hs00249384_m1 and Hs00895050_m1 respectively, Life Technologies). Normalization of ST2 expression was performed using GADD45a (Hs00169255_m1 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of total RNA was reverse transcribed using an oligo-(dT)12-18 primer and Superscript III (Invitrogen). Quantitative PCR gene expression analysis was conducted using a LightCycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: HDAC1 was amplified from w1118 cDNA using the primer pair CACCATGCAGTCTCACAGCAAAAAGC/TCAAATGTTGTTCTCCTTGGCG and inserted into pENTR/D-TOPO (Invitrogen). S391A and S391D mutations were introduced by site directed mutagenesis ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA served as template in qPCR with gene-specific primers (S1 Table) and SYBR Green Master Mix (Applied Biosystems) using a StepOnePlus system according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... 0.24 µL of each primer (10X) and 0.52 µL of RNase- and DNase-free water (Thermo Fisher Scientific, USA). Negative controls constituted of RT- and cDNA-free samples ...
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR was carried out using sequence-specific primers and with PowerTrack SYBR green master mix (ThermoFisher, catalog number: A46109). Relative mRNA expression was calculated by the 2−ΔΔCT method of quantitative PCR after normalization with 18S rRNA levels ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of cDNA and corresponding primers were used for qPCR using SYBR Green Master Mix (Thermo Fisher Scientific) and a CFX384 real-time system/C100 Touch Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Systems Biology 2024Quote: RNA from the input pool and 80S fractions was reverse transcribed using XXX primer using Superscript III (Invitrogen 18080093). The resulting full-length cDNA was gel-purified and ligated to the 5′ adaptor OWG920 with High Concentration T4 RNA Ligase (NEB M0437M ...
-
bioRxiv - Genomics 2023Quote: ... 5μl dNTP and 1μl 10μM reporter gene specific primer: CTCATCAATGTATCTTATCATGTCTG using the Invitrogen SuperScript III First-Strand Synthesis System (Invitrogen 18080051) following the manufactory’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Isolated RNA was reverse transcribed into cDNA using oligo (dT) primers and random hexamers and iscript Reverse Transcriptase (ThermoFisher). qRT-PCR was performed on an EP Real-Plex MasterCycler (Eppendorf ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was reverse transcribed into cDNA using random hexameric primers and the M-MLV reverse transcriptase (ThermoFisher Scientific) by the following program ...
-
bioRxiv - Physiology 2023Quote: ... Total RNA was reverse transcribed to cDNA using High Capacity cDNA Reverse Transcription Kits with random primers (Applied Biosystems). qPCR was performed using a StepOnePlus Real-Time PCR system (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... 0.3 μM of each primer and 0.5 U of the hot-start Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA). PCR reactions were carried out for 35 cycles (94°C for 30 s ...
-
bioRxiv - Physiology 2024Quote: 500ng of RNA was used to synthesize complementary DNA (cDNA) with random primers and Superscript III reverse-transcriptase (Invitrogen). 5ng of cDNA was then used for Quantitative RT-PCR with SYBR Green and a Bio-Rad CFX96 Real-Time System ...
-
bioRxiv - Microbiology 2024Quote: ... The first strand cDNA was obtained using oligo(dT) primers and Moloney murine leukaemia virus-reverse transcriptase (Life Technologies), using 100 ng of purified RNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... normalized against GAPDH with specific primers (Table.1) using SYBR (R) GREEN JUMPSTART TAQ Ready mix (Thermo Fisher Scientific) using Real-time thermal cycler analysis (ΔCT values).
-
bioRxiv - Cell Biology 2024Quote: ... Plasmids were extracted from the selected colonies and sequence confirmed through sequencing with M13 primers (Invitrogen; N52002 and N53002).
-
bioRxiv - Cell Biology 2024Quote: ... and reverse transcription was performed using SuperScript IV First-Strand Synthesis System with oligo(dT)20 primers (Invitrogen #18091050). Real-time PCR using a C1000 thermal cycler with a CFX96 optical reaction module (Bio-Rad) ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA was first denatured at 70 °C for 5 min in the presence of 2.5 µg of random hexamer primers (Invitrogen). For the subsequent RT reaction ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5µl of each primer (10mM) and 10µl of 2x Phusion Flash High-Fidelity MasterMix (Thermo Scientific, Waltham, MA, USA). The PCR consisted of an initial denaturation at 95°C/3min ...
-
bioRxiv - Neuroscience 2024Quote: ... Gene amplification was achieved by employing TaqMan Gene Expression Assays and the following primers (all from Thermo Fisher Scientific): human-ISG15:Hs01921425_s1 ...
-
bioRxiv - Cell Biology 2019Quote: ... Quantitative real-time PCR was performed on a high-productivity real-time quantitative PCR ViiATM 7 system (Life Technologies, U.S.A.) using GoTaq® qPCR Master Mix (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... and subsequently measured by real-time PCR with the Taqman universal PCR master mix and specific Taqman probes (Applied Biosystems). Sequences of primers are shown in Supplementary Table 2.
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative PCR (qPCR) was performed using Fast Sybr Green chemistry on the 7900HT Fast Real-Time PCR System (Applied Biosystems) and gene-specific primers (Supplemental Table 1) ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative reverse transcriptase PCR (qPCR) was carried out by QuantStudio® 12 K Flex Real-Time PCR System (Life Technologies) using TaqMan Gene Expression Assay (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative real-time PCR was run on a ViiA 7 or QuantStudio 6 Flex PCR thermal cycler (Thermo Fisher Scientific) using SensiMix™ SYBR® No-ROX Kit (Bioline ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 ng/rxn of cDNA was then used in qRT-PCR using PowerSYBR™ Green PCR Master Mix (Applied Biosystems) with QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Pooled PCR products were sequenced after emulsion PCR with the Ion OneTouch system and Ion OT2 400 kit (Life Technologies) on Ion 314 chips with Ion PGM Sequencing 400 Kit (Life Technologies) ...