Labshake search
Citations for Thermo Fisher :
9101 - 9150 of 9391 citations for Mumps Virus Nucleoprotein Strain L Zagreb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... A volume of 20 μL Sera-Mag A beads were combined with 20 μL of Sera-Mag B beads and washed with 160 μL of water by placing the water-bead mixture on a magnetic rack for PCR tubes (DynaMag PCR Magnet, Thermo Scientific, Cat: 492025), and beads were settled for 2 minutes ...
-
bioRxiv - Immunology 2021Quote: ... prepared with 2 µl 2X lysis buffer (100 mM Tris.HCl, pH 8.0, 100 mM NaCl, 40 µg/ml Proteinase K (Ambion, AM2546, 20 mg/ml stock) and 0.4% SDS ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2012) (a gift from Andrew Jackson) at 1:300 and rabbit anti sheep IgG (H+L) secondary link antibody (Invitrogen #31240 1:4000) following Leica BondRx standard IHC protocols ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 2 mM L-glutamine, antibiotics (100 U/ml penicillin, 100 μg/ml streptomycin) and 10 % fetal bovine serum (Thermo Fisher Scientific, USA). The cells were detached from the culture flask using 0.25 % (w/v ...
-
bioRxiv - Cancer Biology 2021Quote: A375 and MelJuso cells (ATCC, Manassas, VA, USA and DSMZ, Braunschweig, Germany) were maintained in RPMI-1640 with L-glutamine (Gibco, Life Technologies, Darmstadt, Germany) supplemented with 10% (v/v ...
-
bioRxiv - Cancer Biology 2021Quote: ... and fibroblasts were extracted from fresh discarded human foreskin and surgical specimens as previously described.28,91–93 Keratinocytes were cultured in a 1:1 mixture of Gibco Keratinocytes-SFM medium + L-glutamine + EGF + BPE and Gibco Cascade Biologics 154 medium with 1% penicillin-streptomycin (Thermo Fisher Scientific. # 15140122). Fibroblasts were cultured in DMEM (Mediatech ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human breast cancer cells MDA-MB-231 and Hs 578T were maintained in RPMI supplemented with 2 mM L-glutamine (ThermoFisher Scientific, 25030-24), non-essential amino acids (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... pahangi parasites were washed several times in warmed worm culture media (RPMI with 1% HEPES, 1% L-glutamine, 0.2% Penicillin/Streptomycin, and 1% w/v glucose [all Thermo Fisher Scientific, Waltham, MA]) and then counted and cultured at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2020Quote: ... Alexa Fluor 488 goat anti-rabbit IgG (H+L) and Alexa Fluor 488 goat anti-mouse IgG1 (g1) were purchased from Fisher Scientific (Waltham, MA).
-
bioRxiv - Molecular Biology 2021Quote: ... using DMEM (4.5 g/l glucose) with 2 mM Glutamax-I medium supplemented with 15% foetal calf serum (FCS) (ThermoFisher Scientific, Cat# 10270-106), 0.1% β-mercaptoethanol (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: HEp-2 (ATCC, CCL-23, Manassas, VA, USA) cells were maintained in MEM with Earle’s salts and L-glutamine (Gibco Laboratories, Gaithersburg, MD, USA), 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2021Quote: ... L-glutamine and penicillin/streptomycin (10 μg/ml) and supplemented with MEM Non-Essential Amino Acids Solution (NEAA) (Gibco Life Technologies, Gaithersburg, Md.). To create a monolayer of polarized cells ...
-
bioRxiv - Immunology 2021Quote: ... L-glutamine and penicillin/streptomycin (10 μg/ml) and supplemented with MEM Non-Essential Amino Acids Solution (NEAA) (Gibco Life Technologies, Gaithersburg, Md.). To create a monolayer of polarized cells ...
-
bioRxiv - Microbiology 2020Quote: The plasmids containing H- or L-chain genes (50 µg each) were transduced to 1 × 108 293F cells using 293fectin reagent (ThermoFisher Scientific, Waltham, MA). After incubating the cells at 37°C for 4 days ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were pelleted by 4 min centrifugation at 800 rpm at room temperature and resuspended in DMEM/BSA (DMEM/F-12 without phenol red, with L-glutamine and 10 mM HEPES, 0.1% bovine serum albumin; Gibco®, Thermo Fisher Scientific) at a concentration of 5×106 cells/ml ...
-
bioRxiv - Developmental Biology 2022Quote: ... Xenopus laevis npr3.L (Accession number# BC170137) was amplified by PCR with the Pure Taq Ready-to-go PCR beads (ThermoFisher Scientific; Waltham, MA) using NF stage 35 cDNA as template and the following primers (F:TGGAAGGATGTCCTCTATGC ...
-
bioRxiv - Molecular Biology 2022Quote: ... diluted 1:100 in blocking solution was followed by a 1-hour incubation with Alexa Fluor 568 Donkey anti-Sheep IgG (H+L) secondary antibody (Invitrogen, A-21099, RRID:AB_2535753) diluted 1:400 in blocking solution ...
-
bioRxiv - Bioengineering 2022Quote: ... All cells were seeded in RPMI media (supplemented with 10% fetal bovine serum (FBS) and 2 mM L-glutamine (Gibco, Life Technologies, Stockholm, Sweden) and were for 48h prior experiments cultured in RPMI-media with exosome-depleted FBS (10% ...
-
Driving Osteocytogenesis from Mesenchymal Stem Cells in Osteon-like Biomimetic Nanofibrous ScaffoldsbioRxiv - Bioengineering 2022Quote: ... the samples were washed and incubated with a secondary antibody: Goat Anti-Rabbit IgG H&L (Alexa Fluor® 568, Life Technologies, Australia) for Col I ...
-
bioRxiv - Cell Biology 2022Quote: ... The CHO-K1 cells were grown in low glucose (1.0 g/L) Dulbecco’s modified Eagle’s medium (DMEM; Thermo Fisher Scientific, Cat. no. 11,885-084) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Genomics 2022Quote: ... DNA ligation products were resuspended in 130μl of nuclease free water and concentration was assessed by fluorimetric quantification using the Qubit dsDNA HS Assay Kit (Thermo Fisher cat. #Q32851).
-
bioRxiv - Immunology 2022Quote: ... were blocked with R10 (RPMI 1640 supplemented with 10% FBS, 1% antibiotic-antimycotic [Thermo Fisher Scientific, Waltham, MA], and 1% L-glutamine [Thermo Fisher Scientific]), and individual peptides were added to each well at a final concentration of 10μM ...
-
bioRxiv - Microbiology 2022Quote: ... Alexa Fluor™ 647 Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody (1:500; Thermo Fisher Scientific cat. No. A315712) and Alexa Fluor™ 488 Goat anti-Rabbit IgG (H+L ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The cells were washed 5x with blocking solution and a 1:500 dilution of secondary antibodies (Invitrogen Goat anti-rabbit IgG (H+L) Superclonal™/Invitrogen Alexa Fluor™ 594 goat anti-mouse IgG2a (γ2a ...
-
bioRxiv - Neuroscience 2023Quote: ... slides were washed in PBS three times and incubated in goat anti-chicken (H&L) Alexa Fluor 488 (A11039; Invitrogen, Thermo Fisher Scientific) goat anti-mouse IgG1 Alexa Fluor 555 (A21127 ...
-
bioRxiv - Physiology 2023Quote: ... at 37°C for 1h and subsequently with donkey anti-rabbit IgG (H+L) Highly Cross-Adsorbed Secondary AntibodyAlexa-647 (ThermoFisher Scientific #A-31573) at 37°C for 1h ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were washed 3×5 min with 0.1M PB and incubated with the appropriate Alexa-fluorophore-conjugated secondary antibodies including goat anti-chicken IgY (H+L) Alexa-Fluor 488 IgY (Life Technologies Scientific; A11039), goat anti-rabbit IgG (H+L ...
-
bioRxiv - Microbiology 2024Quote: ... Detection of the murine-human chimera 72A1 detection was performed using goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody Alexa Fluor™ 488 tagged (Invitrogen #A-11001).
-
bioRxiv - Neuroscience 2022Quote: ... 1:1000) and then incubated with secondary antibodies Anti-Rabbit IgG (H+L) Alexa Fluor Plus 488 conjugated (Invitrogen, Cat#A11070, 1:1000), Anti-Rabbit IgG (H+L ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... the cells in CellCarrier-384 Ultra microplates were treated with 25 μ L of 0.71 μM MitoTracker™ Deep Red FM (ThermoFisher, cat #: M22426) that was prepared in cell culture medium from 1 mM DMSO stock (final concentration of MitoTracker™ Deep Red FM is 0.25 μM) ...
-
bioRxiv - Cell Biology 2022Quote: ... End1s were transfected with either an ON-TARGETplus non-targeting siRNA pool (Horizon Discovery D-001810-10-05) or an ON-TARGETplus YAP1-targeting siRNA SMARTpool (Horizon Discovery L-012200-00-0005) using Lipofectamine 3000 (Thermo Fisher Scientific L3000008), per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... All sections were mounted with 50μl of ProLong Gold Antifade mounting media containing a fluorescent nucleic acid dye 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, P36931) before imaging ...
-
bioRxiv - Microbiology 2024Quote: ... The attached corneocytes were infected with 250μl bacterial suspension at 2×107 CFU/ml in CO2 independent media supplemented with 10% FBS and 1% GlutaMax™ (Thermo Fisher Scientific). After 3h incubation at 37°C and 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Stock solutions of CuPT (50 mg/L) were prepared in the dark by dissolving CuPT (CAS# 14915-37-8, purchased from Acros Organics, now Thermo Fisher Scientific) powder in the nontoxic organic solvent dimethyl sulfoxide (DMSO ...
-
bioRxiv - Neuroscience 2023Quote: Secondary antibodies: Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody (Alexa Fluor 488, Thermo Fisher Scientific, A-21202, 1:1000), Donkey anti-Mouse IgG (H+L ...
-
bioRxiv - Cancer Biology 2024Quote: HeLa cells were obtained from ATCC and cultured in DMEM high-glucose with L-Glutamine and Sodium pyruvate (Thermo Fisher Scientific #41966-029), supplemented with 2 mM L-Glutamine (Sigma #G7513 ...
-
bioRxiv - Genetics 2024Quote: ... then incubated with 1:500 (4 µg/mL) dilution goat anti-rabbit IgG (H+L) AlexaFlour®488 antibody (Invitrogen, catalog # A-11008) in 2% NGS in 1X PBS for 1 hour ...
-
bioRxiv - Biochemistry 2024Quote: ... using a rabbit anti-WCTD antibody (GeneScript) (1:100) and Alexa Fluor 647 Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary antibody (Invitrogen, Cat# A-31573) (1:500) ...
-
bioRxiv - Cell Biology 2024Quote: Co-immunoprecipitation for the MeCP2-Flag and hnRNP L-HA interaction was performed using a Pierce™ Co-IP Kit (Thermo Scientific, 26149) following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... The slides were first washed in PBS for 30 min and then incubated with donkey anti-rabbit IgG (H+L) highly cross-adsorbed secondary antibody Alexa Fluor™ 555 or 647 (1:800; Invitrogen, Thermo Fisher Scientific) at RT for 2 hr ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Deionized Milli-Q water up to a resistivity of 18 MΩ L cm was purified with a purification system (Barnstead EASYpure RoDi ultrapure water purification system, Thermo scientific, Ohio, USA).
-
bioRxiv - Microbiology 2024Quote: ... DDX17 (L-013450-01-0005) or non-targeting Control Pool (D-001810-10-05) using the Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific, #11668019) according to the manufacturer’s instructions in 6 well plates ...
-
bioRxiv - Developmental Biology 2024Quote: ... Secondary antibodies used in this study were Donkey anti-Rabbit IgG (H+L) Alexa Fluor Plus 555 (1:1000, Thermo Scientific, cat# A32794), Donkey anti-Rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2024Quote: Incubation with the following secondary antibodies Goat anti-Mouse IgG (H+L) Alexa Fluor™ Plus 488 (Invitrogen, A32723, dilution of 1/800) and Goat anti-Rabbit IgG (H+L ...
-
bioRxiv - Genomics 2024Quote: ... tissue-culture plates in DMEM (4.5 g/L glucose) with GlutaMAX-I supplemented with ES-tested 15% foetal calf serum (FCS, ThermoFisher Scientific, Cat# 10270-106), 0.1% β-mercaptoethanol (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Digested ends were filled and labeled with biotin by adding 37.5 µL 0.4 mmol/L Biotin-14-dATP (Thermo Fisher Scientific, catalog No. 19524016), 1.5 µL 10 mmol/L dCTP ...
-
bioRxiv - Biochemistry 2023Quote: Kinetic measurements of TrpBwt and its mutants were performed by monitoring 5-fluoro-L-Trp formation in a plate reader (Thermo Scientific Varioskan Lux) over 20 min at 290 nm using ΔE290 = 1.89 mM−1·cm−1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with PBS followed by incubation with goat anti-rabbit IgG (H+L) Alexa fluor-594 secondary antibody (A-11012 from Thermo Scientific (Rockford, IL) was used for EphA2 ...
-
bioRxiv - Immunology 2023Quote: Ex vivo isolated and rested CD8+ T cells or transduced T cells from splenocytes were incubated with R10 (RPMI 1640 + 10% FBS + 1% penicillin/streptomycin + L-glutamine + 20 U/ml of IL-2; Gibco, Thermo Fisher Scientific) alone or R10 containing PMA/ionomycin for two hours ...
-
bioRxiv - Immunology 2024Quote: ... ii) incubation with the donkey anti-mouse IgG (H+L) antibody coupled to Alexa Fluor 555 (Invitrogen, cat. A-31570, dilution 1:500) for 30min at room temperature ...