Labshake search
Citations for Thermo Fisher :
5101 - 5150 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... gondii tachyzoites were cultured in human foreskin fibroblasts in Dulbecco’s modified Eagle’s medium (Gibco: 11960-051) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2024Quote: ... and live/dead cell number was assessed using a Countess II Automated Cell Counter (Thermo Fisher). To measure cytotoxicity in live culture ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was precipitated with isopropanol (Fisher Scientific: AC327272500), washed with 75% ethanol (VWR ...
-
bioRxiv - Cell Biology 2024Quote: ... Dihydrochloride (DAPI) (Invitrogen, D1306, 1:20,000) for 5 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... and cDNA was synthesized using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific: 18080093) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% antibiotics (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... permeabilized with 0.5% Triton X-100 (Fisher Scientific: BP151-500) and blocked with 5% BSA ...
-
bioRxiv - Cell Biology 2024Quote: ... Matrigel (Fisher Scientific: CB-40234) was diluted to 50ug/mL in DPBS to coat the top and bottom sides of the inserts of an Incucyte Clearview 96-well plate (Sartorius ...
-
bioRxiv - Immunology 2024Quote: ... and PI (Invitrogen, dilution 1:100) for 20 minutes on ice ...
-
bioRxiv - Immunology 2024Quote: ... mRNA-LNPs were evaluated for encapsulation efficiency and mRNA concentration using RiboGreen assay using the Quant-iT RiboGreen RNA Assay Kit (Catalog # R11490, Invitrogen, Thermo Fisher Scientific).
-
bioRxiv - Immunology 2024Quote: ... a custom ψ-probe was designed for participant P2 (FAM-TGGCGTACTCACCAGG-MGBNFQ; Applied Biosystems), and a custom ψ-forward primer was designed for participant P2 (CAGGACTCGGCTTGCTGAGC)20 ...
-
bioRxiv - Immunology 2024Quote: ... and quantified by Qubit dsDNA BR (Invitrogen Q33265). A total of 1µg of the purified PCR product was used for in vitro transcription using the HiScribe T7 High Yield RNA synthesis (NEB E2040S) ...
-
bioRxiv - Immunology 2024Quote: ... 96-well flat bottom plates MaxiSorp (Thermo Scientific) were coated with 0.1μ/well of the respective spike protein ...
-
bioRxiv - Immunology 2024Quote: ... and soluble membrane protein (SMP) preps were extracted from Chinese hamster ovary (CHO) cells and were biotinylated using an NHS-LC-Biotin kit (ThermoFisher Scientific). Yeast displaying IgGs on their surface were incubated with biotinylated SCP and SMP preps at a 1:10 dilution in PBSF (PBS with 0.1% w/v BSA ...
-
bioRxiv - Immunology 2024Quote: ... 0.5 µM of primers and 1U of Platinum Taq High Fidelity DNA Polymerase (Invitrogen 11304102) in a final volume of 40ul ...
-
bioRxiv - Immunology 2024Quote: ... consisting of 30U of Maxima H Reverse Transcriptase (Thermo Fisher EP0753), 1µM of template-switching oligo and 1µM of HIV-tailed oligodT primers ...
-
bioRxiv - Immunology 2024Quote: ... A Vitrobot Mark IV (ThermoFisher Scientific) was used to plunge freeze the grids at 10 ℃ and 100% humidity with a blot time of 3.5 seconds ...
-
bioRxiv - Immunology 2024Quote: Colon carcinoma cell lines HCT-116 and DLD-1 were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and grown in a RPMI- 1640 medium (GIBCO/BRL) supplemented with 10% FBS (GIBCO/BRL ...
-
bioRxiv - Immunology 2024Quote: ... mRNA-LNPs were evaluated for encapsulation efficiency and mRNA concentration using RiboGreen assay using the Quant-iT RiboGreen RNA Assay Kit (Catalog # R11490, Invitrogen, Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2024Quote: ... with 1X Glutamax (Gibco), 10 mM HEPES (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2024Quote: ... and PE-Cy5–labeled antibodies against CD14 (Thermo Fisher Scientific; clone 61D3) and CD16 (BioLegend ...
-
bioRxiv - Immunology 2024Quote: ... NanoDrop 2000 and Qubit 3 Broad Range (Thermo Fisher Scientific) were used to quantify gDNA concentrations.
-
bioRxiv - Immunology 2024Quote: ... supplemented with 10% FBS (GIBCO/BRL) in a humidified chamber at 37 °C and 5% CO2 ...
-
bioRxiv - Immunology 2024Quote: ... between 9 and 4 x 107 CD8-depleted PBMCs were resuspended in RPMI-1640 (GIBCO), supplemented with 10% (v/v ...
-
bioRxiv - Immunology 2024Quote: Intracellular RNA was subjected to complementary DNA (cDNA) synthesis using random hexamer and oligodT and the SuperScript III First-Strand Synthesis System (Thermo Fisher Scientific) in order to measure HIV-1 poly-adenylated RNA transcripts ...
-
bioRxiv - Cancer Biology 2024Quote: ... Primary antibodies were as follows: Spy1 (1:200; PA5-29417; Thermo Fisher Scientific), PCNA (1:500 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The conjugated antibody was quantified in IgG mode at A280 using a NanoDrop (Thermo Scientific, ND-2000). The final concentration was adjusted by adding at least 30% v/v Candor Antibody Stabilizer (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... The final concentration was adjusted by adding at least 30% v/v Candor Antibody Stabilizer (Thermo Fisher Scientific, NC0414486) with additional 0.2% sodium azide ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were maintained in RPMI (Gibco) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by separation on an EASY-Spray column (50 cm x 75 µm ID, PepMap C18, 2 µm, 100 Å) (Thermo Fisher Scientific). Buffer A consisted of water containing 0.1 % FA and Buffer B of 80 % MeCN containing 0.1 % FA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real time PCR was performed using SYBR Green detection (Applied Biosystems) and was performed and analysed using Viia7 Real Time PCR System (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... and was performed and analysed using Viia7 Real Time PCR System (Life Technologies) and software.
-
bioRxiv - Microbiology 2024Quote: ... The final libraries were quantified by Qubit fluorometry (Thermo Fisher Scientific), and the size distribution was analyzed by TapeStation electrophoresis (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... Pierce ECL Western Blotting Substrate (Thermo Scientific) was used for detection and Amersham GE Imager (GE Healthcare ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.4 % (Thermo Fisher). Three independent experiments were analysed.
-
bioRxiv - Microbiology 2024Quote: ... ExpiCHO cells (Thermo Fisher Scientific) were maintained in ExpiCHO expression medium (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: Peptide samples from a 24-hour experiment were injected on a Dionex Ultimate 3000 RSLC (Thermo Fisher Scientific) connected to an Q Exactive Hybrid Quadrupole-Orbitrap mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were maintained in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Slides were mounted with Permount Toluene (Fisher Scientific) solution prior to imaging.
-
bioRxiv - Cancer Biology 2024Quote: ... and A549 cell lines were cultured in Roswell Park Memorial Institute medium (RPMI, Gibco) supplemented with 10 % foetal bovine serum (FBS ...
-
bioRxiv - Immunology 2024Quote: ... and Qubit (Invitrogen) instruments ...
-
bioRxiv - Microbiology 2024Quote: ... The complexes were then applied to grids for electron microscopy analysis or resolved on 4–12% NuPAGE SDS–PAGE gels (Invitrogen) by staining with Instant Blue (Expedeon) ...
-
bioRxiv - Microbiology 2024Quote: ... transmission electron microscope operating at 300 kV equipped with a Falcon 4 direct electron detector (Thermo Fisher Scientific). The camera was operated in electron counting mode and data were collected at a magnification of 96,000× with the nominal pixel size of 0.83 Å and a nominal defocus range of −0.4 to −0.9 μm ...
-
bioRxiv - Microbiology 2024Quote: Data were collected in an automated manner using EPU v.2.6 on a cold-FEG fringe-free Titan Krios G4 (Thermo Fisher Scientific) transmission electron microscope operating at 300 kV equipped with a Falcon 4 direct electron detector (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... protein bands were visualized using an enhanced chemiluminescence detection kit (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2024Quote: ... and lamina propria suspensions fixed for 10 minutes using the Foxp3/Transcription factor staining set (Thermo Fisher 00-5523-00). Cells were then resuspended in 1x permeabilization buffer (Thermo Fisher 00-8333-56 ...
-
bioRxiv - Immunology 2024Quote: ... propidium iodide (PI) (Invitrogen), CD19 PE-Cy7 (Biolegend) ...
-
bioRxiv - Immunology 2024Quote: ... Anti-Human-HRP (Invitrogen) was diluted 1:5000 in 1% BSA/PBS ...
-
bioRxiv - Immunology 2024Quote: IFNγ in supernatants from the whole blood RSA was determined by ELISA according to the manufacturer’s instructions (Human IFNγ Uncoated ELISA kit; Invitrogen). 50μl of supernatant was diluted with 50μl of assay diluent for use in the IFNγ ELISA ...
-
bioRxiv - Immunology 2024Quote: ... corresponding to the concentration of the highest standard of recombinant human IFNγ (Human IFNγ Gamma Uncoated ELISA kit, Invitrogen). IFNγ concentrations below the level of detection by the ELISA standard curve were set to 0 pg/ml ...