Labshake search
Citations for Macherey-Nagel GmbH :
301 - 350 of 3263 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... The PCR product was run on a 1% agarose gel and subsequently purified using the NucleoSpin Gel and PCR Cleanup kit (Macherey-Nagel) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2024Quote: ... PCR products were purified with PCR clean up kit from Macherey-Nagel. Equal molar concentrations of PCR product were mixed and 5 µL of mix was added to 15 µL of Gibson Master mix ...
-
bioRxiv - Systems Biology 2024Quote: ... PCR products were purified with PCR clean up kit from Macherey-Nagel. Equal molar concentrations of PCR product were mixed (one from either pMD019 or pMD024 and one from pCRRNA ...
-
bioRxiv - Plant Biology 2024Quote: RNA was extracted from 50 mg of frozen and fine ground rosette leaf material from four biological replicates per genotype and growth condition using the NucleoSpin RNA Plant Kit (Macherey-Nagel, Düren, Germany), according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1000 ng of total RNAs were isolated using the Nucleospin RNA kit (Macherey-Nagel, 740955) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted using Nucleospin RNA kit (Macherey-Nagel, 740955) or RNeasy Plus Micro (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... The rest of the PCRs were purified with the NucleoSpin Gel and PCR Clean-up XS kit (#740611.50, Macherey-Nagel) for long-read amplicon sequencing using Oxford Nanopore Technology (via Plasmidsaurus).
-
bioRxiv - Cell Biology 2024Quote: Total RNA extraction was performed using the NucleoSpinRNA kit (Macherey-Nagel) as specified by the manufacturer ...
-
bioRxiv - Cell Biology 2024Quote: ... Maxiprep was performed according to the manufacturer’s instructions (NucleoBond® Xtra Maxi Plus EF, Macherey-Nagel), and ...
-
bioRxiv - Cancer Biology 2024Quote: ... Genomic DNA (gDNA) was exptracted using the NucleoSpin Blood XL kit (Macherey-Nagel, # 740950.50). The gDNA was amplified according to Broad Genome Perturbation Portal protocols and single end 100 cycle sequencing was performed on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was isolated using the NucleoSpin RNA kit (Macherey-Nagel) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... The resulting PCR product was gel purified using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel) and 3’ A-overhangs were added by incubation with Taq-polymerase (DreamTaq Green PCR Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and constructs were purified using the manufacture’s instruction of the MIDI-Prep system (Macherey-Nagel, #740410.10) The cloned nucleotides were confirmed by sanger sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... total RNAs were isolated from HeLa and HEK293 cells using the NucleoSpin RNA kit (Macherey-Nagel). To examine endogenous mRNA expression levels and the splicing products ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was purified with a commercial gel and PCR clean-up kit (Macherey-Nagel, Germany) and was used directly for quantitative PCR with SimpleChIP human CDKN1A promoter primers (Cell Signaling Technology ...
-
bioRxiv - Biochemistry 2024Quote: All proteins were purified using Ni-IDA (Macherey-Nagel) following the instructions provided by the manufacturer ...
-
bioRxiv - Biochemistry 2024Quote: ... After cell lysis using a French press the cell debris was removed by centrifugation at 17000 g for 1 h at 4 °C and the cleared lysate was incubated with Protino IDA resin (Macherey-Nagel) for 20 min at 4° C ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA fragments encoding the open reading frame (ORF) of the nanobodies with 15-bp complementary overhangs were amplified using PCR and purified from agarose gel bands (Macherey-Nagel Ref 740609.50). A pAAV vector ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR products for each single cell clone were combined and purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel). Afterward using a second round of PCR ...
-
bioRxiv - Biochemistry 2024Quote: RNA from 10 mL yeast culture was isolated using a mini kit for RNA isolation (Macherey-NAGEL, REF 740933.50). Next ...
-
bioRxiv - Biochemistry 2024Quote: ... after which positive colonies were purified using a Nucleospin Plasmid miniprep kit (Macherey-Nagel) and sent for Sanger Sequencing on an Applied Biosystems 3730XL DNA Analyzer (Neuromics Support Facility ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... RNA extraction was carried out with the NucleoSpin RNA kit (Macherey-Nagel, #740955) following the guidelines provided by the manufacturer ...
-
bioRxiv - Cell Biology 2024Quote: ... Nucleospin Gel and PCR clean-up kit (Macherey-Nagel) was employed to purify DNA from the gel ...
-
bioRxiv - Microbiology 2024Quote: ... was performed either when all ammonium (or nitrate) and nitrite was depleted, or when the values stayed constant for 1-3 days (qualitatively, using Quantofix (Macherey-Nagel) strips) ...
-
bioRxiv - Biochemistry 2024Quote: ... Following sample purification using a NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL), T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: Products formed in in vitro reactions were quantified via GC-FID using a non-chiral OPTIMA™ 5MS column (Macherey-Nagel GmbH & Co. KG, Düren, Germany). Substrates and products were directly extracted from the aqueous reaction solutions with DCM containing 2 mM acetophenone as an internal standard ...
-
bioRxiv - Plant Biology 2024Quote: ... All GST-tag proteins were purified using Protino Glutathione Agarose 4B (Macherey-Nagel, Düren, Germany). Lipid binding assays were performed following the previous description using TBS buffer on PIP-strips P-6001 (Echelon ...
-
bioRxiv - Plant Biology 2024Quote: ... The extraction of fungal genomic DNA was performed using NucleoSpin® Plant II Kit (Macherey-Nagel, Dueren, Germany) following the instructions of the manufacturer ...
-
bioRxiv - Neuroscience 2024Quote: ... After adding 20 μL N-methyl-N-trimethylsilyl-trifluoroacetamide (MSTFA; Macherey-Nagel), samples were incubated for an additional 30 min at 45 °C under continuous shaking.
-
bioRxiv - Bioengineering 2024Quote: ... plasmids were isolated with a plasmid preparation kit (740588, Macherey-Nagel) from a 3 mL overnight culture grown at 30 °C with 160 rpm in LB with 34 µg/mL chloramphenicol and 2% (w/v ...
-
bioRxiv - Neuroscience 2024Quote: Total vessel RNAs were extracted using the “Nucleospin RNA XS” kit (Macherey-Nagel) according to the supplier’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was extracted using RNA isolation NucleoZol (Macherey-Nagel) according to the manufacturer’s instructions and treated with RQ1 RNase-free DNase (Promega) ...
-
bioRxiv - Plant Biology 2024Quote: ... attenuata by utilizing the plant RNA purification kit (Macherey-Nagel) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from plant samples using NucleoSpin RNA (Macherey-Nagel). Total RNA was used for reverse transcription by the ReverTra Ace qPCR RT Master Mix (Toyobo) ...
-
bioRxiv - Plant Biology 2024Quote: ... Maize leaf discs sampled at 4 dpi were homogenized using metal beads in a Retsch mixer mill and fungal genomic DNA was extracted with NucleoSpin® Plant II Kit (Macherey-Nagel, Dueren, Germany) as explained before ...
-
bioRxiv - Plant Biology 2024Quote: ... and purified by phenol/chloroform extraction and ethanol precipitation or by using the Nucleospin RNA Mini Kit (Macherey-Nagel, Düren, Germany, #740955.50).
-
bioRxiv - Biophysics 2024Quote: ... The lysate was clarified by centrifugation (7197g for 30 min) and applied twice at 4 °C to a Protino Ni-IDA 2000 column (Macherey-Nagel), pre-equilibrated with IMAC buffer containing 50 mM sodium phosphate buffer pH 8.0 and 300mM NaCl ...
-
bioRxiv - Biophysics 2024Quote: ... A 2-μl aliquot of each sample was spotted on a TLC sheet (SIL/UV254, Macherey-Nagel), and the sheet developed in a mixture of n-butanol ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was isolated using the NucleoSpin RNA isolation kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA isolation was performed by using the NucleoSpin® RNA kit (MACHEREY-NAGEL, 740955.50) as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA was isolated using NucleoSpin RNA Plus (Macherey-Nagel, Duren, Germany, Cat. No. 740984.250) at the respective specified time ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were cleaned up using NucleoSpin Gel and PCR Clean-Up kit (Macherey-Nagel) and Sanger sequenced using the forward primer at Macrogen Europe ...
-
bioRxiv - Cancer Biology 2024Quote: ... and constructs were purified using the manufacture’s instruction of the MIDI-Prep system (Macherey-Nagel, #740410.10). The cloned nucleotides were confirmed by sanger sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were homogenized in MR1 buffer (Macherey-Nagel) using a Pellet Pestle Motor (Kimbal) ...
-
bioRxiv - Neuroscience 2024Quote: ... Total RNA was isolated from tissue using the NucleoMag RNA Kit (Macherey-Nagel) and the KingFisher Flex purification system (ThermoFisher ...
-
bioRxiv - Neuroscience 2024Quote: ... genomic DNA was isolated using a Macherey-Nagel Blood L kit (Macherey-Nagel; Cat. No. 740954.20) and sgRNA sequences were amplified and sequenced on an Illumina MiSeq V3.
-
bioRxiv - Cell Biology 2024Quote: RNA was isolated from the interphase of extracted cells as described before [20] by using the NucleoSpin® RNA kit (MACHEREY-NAGEL, 740955.50). Isolated RNA was converted to cDNA by using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™ ...
-
bioRxiv - Biophysics 2024Quote: ... using mouse genomic DNA as a template and primer pairs 5’CAAAGAGCTCCTCGTCCAGT3’ and 5’ ATGGACTCCAGGACCCAAGA3’ followed by a column purification using the NucleoSpinⓇ Gel and PCR Clean-up Kit (Macherey-Nagel). For the in vitro cleavage assay ...
-
bioRxiv - Cancer Biology 2024Quote: ... then resuspended in lysis buffer from NucleoSpin RNA kit (Macherey-Nagel,Germany). Further RNA extraction followed the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was extracted using NucleoSpin® RNA kit (Macherey-Nagel, Bethlehem, PA, USA). RNA quality and quantity were assessed using Nanodrop-2000 (Thermo Fisher Scientific ...