Labshake search
Citations for Macherey-Nagel GmbH :
251 - 300 of 3300 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... A 2-μl aliquot of each sample was spotted on a TLC sheet (SIL/UV254, Macherey-Nagel), and the sheet developed in a mixture of n-butanol ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was isolated using the NucleoSpin RNA isolation kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA isolation was performed by using the NucleoSpin® RNA kit (MACHEREY-NAGEL, 740955.50) as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA was isolated using NucleoSpin RNA Plus (Macherey-Nagel, Duren, Germany, Cat. No. 740984.250) at the respective specified time ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were cleaned up using NucleoSpin Gel and PCR Clean-Up kit (Macherey-Nagel) and Sanger sequenced using the forward primer at Macrogen Europe ...
-
bioRxiv - Cancer Biology 2024Quote: ... and constructs were purified using the manufacture’s instruction of the MIDI-Prep system (Macherey-Nagel, #740410.10). The cloned nucleotides were confirmed by sanger sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were homogenized in MR1 buffer (Macherey-Nagel) using a Pellet Pestle Motor (Kimbal) ...
-
bioRxiv - Neuroscience 2024Quote: ... Total RNA was isolated from tissue using the NucleoMag RNA Kit (Macherey-Nagel) and the KingFisher Flex purification system (ThermoFisher ...
-
bioRxiv - Neuroscience 2024Quote: ... genomic DNA was isolated using a Macherey-Nagel Blood L kit (Macherey-Nagel; Cat. No. 740954.20) and sgRNA sequences were amplified and sequenced on an Illumina MiSeq V3.
-
bioRxiv - Cell Biology 2024Quote: RNA was isolated from the interphase of extracted cells as described before [20] by using the NucleoSpin® RNA kit (MACHEREY-NAGEL, 740955.50). Isolated RNA was converted to cDNA by using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™ ...
-
bioRxiv - Biophysics 2024Quote: ... using mouse genomic DNA as a template and primer pairs 5’CAAAGAGCTCCTCGTCCAGT3’ and 5’ ATGGACTCCAGGACCCAAGA3’ followed by a column purification using the NucleoSpinⓇ Gel and PCR Clean-up Kit (Macherey-Nagel). For the in vitro cleavage assay ...
-
bioRxiv - Cancer Biology 2024Quote: ... then resuspended in lysis buffer from NucleoSpin RNA kit (Macherey-Nagel,Germany). Further RNA extraction followed the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was extracted using NucleoSpin® RNA kit (Macherey-Nagel, Bethlehem, PA, USA). RNA quality and quantity were assessed using Nanodrop-2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmid preparation and DNA gel extraction were performed using the Nucleospin Plasmid and the Nucleospin Extract II kits (Macherey-Nagel, Lab Supplies Scientific SA, Hellas). Restriction enzymes were from Takara Bio (Lab Supplies Scientific SA ...
-
bioRxiv - Plant Biology 2024Quote: ... glycines J2 worms following treatment with CPR1-dsRNA or GFP-dsRNA control using the Nucleospin microRNA kit (Macherey-Nagel, Hoerdt, France). First-strand cDNA was synthesized and served as a template for PCR ...
-
bioRxiv - Synthetic Biology 2024Quote: ... beads were separated and peptides containing supernatant was collected and further purified and desalted by C18-solid phase extraction using Chromabound spin columns (Macherey-Nagel). Cartridges were prepared by adding acetonitrile ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR products were purified using DNA gel extraction with NucleoSpin® Gel and PCR Clean-up kit (MACHEREY-NAGEL, 740609.10). Transformation was performed with purified PCR products in Stellar Competent Cells (Takara ...
-
bioRxiv - Immunology 2024Quote: ... and immediately transferred to a tube containing 400 µL of RA1 lysis buffer from the Nucleospin 96 RNA core kit (Macherey-Nagel) and ∼20 1-mm glass beads (BioSpec) ...
-
bioRxiv - Biochemistry 2024Quote: ... The extract was filtered through a miracloth and filter paper (MN 615, Macherey-Nagel) and evaporated to dryness ...
-
bioRxiv - Cell Biology 2024Quote: RNA was extracted using Nucleospin RNA/protein kit following the manufacturer protocol (Macherey-Nagel, Germany). Reverse transcriptase reaction was performed using 500–1000ng of RNA ...
-
bioRxiv - Cell Biology 2024Quote: mRNAs were quantified in mouse kidneys and cultured cells by quantitative RT-PCR RNA extraction performed as described in the manufacturer’s protocol (NucleoSpin RNA, Macherey-Nagel). cDNA was synthesized with the High-Capacity cDNA Reverse Transcription kit (ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2024Quote: ... A 2-μl aliquot of each sample was spotted on a TLC sheet (SIL/UV254, Macherey-Nagel), and the sheet developed in a mixture of n-butanol ...
-
bioRxiv - Biochemistry 2024Quote: ... coli strain DH5α (NIPPON GENE) and extracted using the NucleoSpin Plasmid EasyPure (MACHEREY-NAGEL) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... The DNA donor fragment was PCR amplified and cleaned up prior to injection using the Gel & PCR Clean-Up Kit (Macherey-Nagel). One cell stage zebrafish embryos were injected with ∼1-2 nl of 2.5 ng/μl DNA donor fragment together with 12.5 ng/μl sgRNA (GGACAATTTTCATGACAAGA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the lipid extracted from each sample was separated using thin layer chromatography (TLC) with silica gel-coated plates (0.25 mm Silica gel, DCFertigplatten, Macherey-Nagel, Germany). The TLC plates were developed using a solvent mixture comprising hexane/diethyl ether/acetic acid (in a 70:30:1 ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the resulting fragment was purified using the NucleoSpin Gel and PCR Clean-up kit according to the manufacturer’s instructions (Macherey-Nagel, 740609.250). The purified CASP3 gene fragment was ligated into the linearized pEGFP-N3 vector using the quick ligationTM kit according to the manufacturer’s instructions (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the plasmid was amplified and purified using the Nucleobond Xtra Midi kit (Macherey-Nagel, 740410.50).
-
bioRxiv - Cancer Biology 2024Quote: ... and the resulting digested fragment was purified using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel, 740609.250). Guide RNAs were designed using the CRISPOR tool (http://crispor.gi.ucsc.edu/ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Column chromatography was carried out under positive pressure using 15-40 µm silica gel (Macherey-Nagel) and the indicated solvents ...
-
bioRxiv - Cancer Biology 2024Quote: ... and plasmid DNA was purified with NucleoSpin Plasmid Mini kit (Macherey-Nagel, Düren, Germany) according to the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... the 28S and 18S bands were cut from the gel and RNA was extracted from agarose using Nucleospin Gel and PCR clean-up (Macherey-Nagel) columns.
-
bioRxiv - Biochemistry 2024Quote: ... and NucleoBond Xtra Midi kit (MACHEREY-NAGEL, 740410.50).
-
bioRxiv - Cancer Biology 2024Quote: ... RNA of sorted cells was isolated by using NucleoSpin RNA XS (Macherey-Nagel) and 20 ng carrier RNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reactions were monitored by analytical thin layer chromatography (TLC) carried out on ALUGRAM Xtra SIL G/UV254 silica gel plates (Macherey-Nagel). Compounds were visualized with a UV lamp (λ = 254 nm ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were washed twice and RNA extraction and purification were performed using NucleoSpin® RNA plus (Macherey-Nagel, 740984.250) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... restriction sites for three hours at 37C and the linearized vector was purified from an agarose gel and cleaned using Nucleospin columns (Macherey-Nagel 740609.50). The C1(1-29)-TurboID ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were harvested and genomic DNA was isolated using NucleoSpin Microbial DNA Mini kit for DNA (Macherey-Nagel). Bacterial genomes were sequenced at Plasmidsaurus (https://www.plasmidsaurus.com/ ...
-
bioRxiv - Microbiology 2024Quote: ... Single colonies were grown in 5 ml liquid LB medium at 37 °C overnight and the plasmid DNA was extracted using NucleoSpin® Plasmid preparation kit according to the manufacturer’s instructions (Macherey-Nagel). Positive clones were identified by restriction digestion and DNA sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... Peptides were desalted by using C18 solid phase extraction cartridges (Macherey-Nagel). Cartridges were prepared by adding acetonitrile (ACN) ...
-
bioRxiv - Microbiology 2024Quote: Total RNA from lung tissue cells for hamsters was isolated using NucleoSpin RNA Kit (740955.250, MACHEREY-NAGEL, Duren, Germany). cDNA libraries were prepared by KAPA mRNA HyperPrep Kit following the standard protocol ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was routinely purified with the NucleoSpin gel and PCR clean-up kit (Macherey-Nagel) according to the manufacturer’s instruction or by ethanol precipitation ...
-
bioRxiv - Microbiology 2024Quote: ... the lysate was treated with 2 µg/µl (w/v) RNAse A (Macherey-Nagel). Genomic DNA of L ...
-
bioRxiv - Microbiology 2024Quote: The genomic ssDNA was isolated from the ion exchange-purified sample of the phage using a Virus DNA kit (Macherey-Nagel). For sequencing on the Oxford Nanopore platform ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from liver pieces (30 mg) using a NucleoSpin kit (Macherey-Nagel cat# 740955.25) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was extracted using the Nucleospin® RNA II kit (Macherey-Nagel, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... gDNA was isolated using the NucleoSpin® gDNA Clean-up Kit from Macherey-Nagel. Isolation was performed according to the manufacturer’s protocol ...
-
Braf-mutant Schwann cells divert to a repair phenotype to induce congenital demyelinating neuropathybioRxiv - Developmental Biology 2024Quote: ... total RNA was extracted using the NucleoSpin RNA Plus S kit (#740984; Macherey-Nagel). RNA concentrations were measured on a NanoDrop (NanoDrop TM 1000 Spectrophotometer ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from cells at the indicated time points post stimulation and/or infection using the NucleoSpin RNA extraction kit (Macherey-Nagel) as directed by manufacturer ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were harvested by scraping in RA1 lysis buffer and total RNA was isolated using the NucleoSpin RNA Mini Kit for RNA Isolation (Macherey-Nagel, 740955) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... using the NucleoSpin RNA kit (Macherey-Nagel, Cat no. 740955.250) according to the manufacturer’s instructions ...