Labshake search
Citations for Macherey-Nagel GmbH :
501 - 550 of 3058 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... and the supernatant was thereafter filtered through a 0.20 µm syringe filter (Chromafil® Xtra PES 20/25, Macherey-Nagel, Germany). Samples were stored at -20°C pending LC-MS analysis.
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated using NucleoSpin RNA II (Macherey-Nagel) and reverse transcribed using Superscript III Transcriptase (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... H1299p53R273H Cas9 and Casp2-/- cells using the Nucleospin RNA kit (Macherey-Nagel GmbH & Co, Germany). Three biological replicates each were prepared ...
-
bioRxiv - Cell Biology 2023Quote: ... The genomic DNA used for WGBS was prepared using a NucleoSpin Tissue Kit (Macherey-Nagel, Dueren, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA of isolated islets was extracted using NucleoSpin RNA XS kit (740902.50, Macherey-Nagel), then normalized RNA was transformed into cDNA using the High-capacity cDNA reverse transcription kit (43-688-14 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The digested vector was purified using the NucleoSpin Gel and PCR Cleanup kit (Macherey-Nagel™, 740609) and then ligated with annealed gRNA oligos ...
-
bioRxiv - Cancer Biology 2023Quote: ... The pooled extracts were further purified on a Chromabond C18 ec polypropylene column (Macherey-Nagel, Dueren, Germany). The extracted glycolipids were digested with LudgerZyme Ceramide Glycanase (CGase ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1000 ng of total RNAs were isolated using the Nucleospin RNA kit (Macherey-Nagel, 740955) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted using Nucleospin RNA kit (Macherey-Nagel, 740955) or RNeasy Plus Micro (Qiagen ...
-
bioRxiv - Biochemistry 2023Quote: ... containing 1819 adenine bases) was amplified by PCR and purified using a NucleoSpin Gel and PCR Clean-up Kit (MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany) with Milli-Q water ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from three replicates of PRMT7-KO2 and control PC3 cells was extracted using the NucleoSpin RNA kit (Macherey-Nagel). mRNA quality control checks and NGS for RNA-seq analysis were performed at the NIMgenetics facility (Madrid ...
-
bioRxiv - Biochemistry 2023Quote: ... All plasmids were amplified and purified using the NucleoBond Xtra Maxi Plus EF (Macherey-Nagel). B55WT and B55LL were individually expressed in Expi293F cells (ThermoFisher) ...
-
bioRxiv - Bioengineering 2023Quote: ... the remaining PCR product was purified using NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel) and Sanger sequenced using both forward and reverse primers.
-
bioRxiv - Bioengineering 2023Quote: ... the solution was filtered through a 0.20 μm syringe filter (Chromafil® Xtra PES 20/25, Macherey-Nagel, Germany), and treated in a similar way to the permeate and liquid samples.
-
bioRxiv - Bioengineering 2023Quote: Genomic DNA was extracted from larvae or pupae of the selected lines using NucleoSpin Tissue gDNA extraction kit (Macherey-Nagel).
-
bioRxiv - Bioengineering 2023Quote: We extracted RNA from live cells for bulk RNA-sequencing using the NucleoSpin totalRNA FFPE micro kit (Macherey-Nagel #740969.50) ...
-
bioRxiv - Bioengineering 2023Quote: MA-AnMBR permeate volumes of 2.0 L (per sample) of permeate were collected anaerobically and filtered through a 0.20 µm filter (Chromafil® Xtra PES 20/25, Macherey-Nagel, Germany). Afterwards ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was extracted using the NucleoSpin RNA kit (Macherey-Nagel, Germany). The RNA concentration and quality were determined by Nanodrop 8000 spectrophotometer (Thermofisher Scientific ...
-
bioRxiv - Evolutionary Biology 2023Quote: RNA was extracted from the heads of 30 male flies using the NucleoZol one phase RNA purification kit (Macherey-Nagel). Library preparation and sequencing was performed by BGI (Wuhan ...
-
bioRxiv - Microbiology 2023Quote: Separation was performed on an EC 100/2 Nucleoshell Phenyl-Hexyl column (2C×C100Cmm, 2.7Cμm; Macherey-Nagel) at 40°C ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were purified with NucleoSpin Gel and PCR Clean-up (Macherey-Nagel) according to the manufacturer’s instructions and DNA concentration was quantified with a NanoDrop spectrophotometer (A260 nm).
-
bioRxiv - Microbiology 2023Quote: ... A NucleoSpin RNA kit (MACHEREY-NAGEL) was used to isolate RNA ...
-
bioRxiv - Microbiology 2023Quote: ... exonuclease V was used to digest the linear DNA in the sample prior to isolation of the residual putative cirDNA using a DNA clean-up kit (NucleoSpin gel and PCR clean-up kit, Macherey-Nagel, Germany). The final cirDNA preparation was dissolved in TE buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were desalted by using C18 solid phase extraction cartridges (Macherey-Nagel). Cartridges were prepared by adding acetonitrile (ACN) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR amplicons were purified (Macherey-Nagel #740609) and sent for Sanger sequencing (Eurofins genomics) ...
-
bioRxiv - Neuroscience 2023Quote: ... and cleaned up using Nucleospin Gel and PCR spin columns (Macherey-Nagel). In-Fusion reactions were transformed into NEB Stable competent cells (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the DNA eluates were de-cross-linked at 65°C overnight with shaking at 900rpm and purified by NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel), according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... Five tubes of each amplicon were pooled and DNA purified using NucleoSpin Gel and PCR Clean-Up (Macherey-Nagel). DNA was eluted in 20 µl of Elution Buffer and concentration was measured using Qubit 3.0 fluorometer (Life Technologies).
-
bioRxiv - Molecular Biology 2023Quote: ... purified through agarose gel electrophoresis using NucleoSpin Gel and PCR Cleanup (Macherey-Nagel), eluted in water and concentrated SpeedVac Concentrator SAVANT SPD 121P (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Gel extraction was performed following manufacturer protocols (Macherey-Nagel GmbH & Co. KG740609). Backbone ligation with the minigene was performed using 40 ng of backbone and a 3:1 molar ratio of the insert (Thermo Fisher Scientific GmbH EL0011) ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted using the NucleoSpin RNA Kit (Macherey-Nagel). Then ...
-
bioRxiv - Molecular Biology 2023Quote: RNA of worms was isolated using NucleoSpin RNA II kit (Macherey-Nagel, Düren, Germany) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... were purified from the reaction with NucleoSpin Gel and PCR Clean-up Mini kit (Macherey-Nagel) according to the manufacturer’s instructions and subjected to a T7 Endonuclease assay (T7EI ...
-
bioRxiv - Neuroscience 2023Quote: ... A fused-silica capillary column Optima 17 (15 m length, 0.25 mm I.D., 0.25 µm film thickness) from Macherey-Nagel (Düren, Germany) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was purified with a commercial gel and PCR clean-up kit (Macherey-Nagel, Germany) and was directly used for quantitative PCR with SimpleChIP human CDKN1A promoter primers (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2023Quote: ... GST-tagged proteins in soluble extracts were purified by GSH-agarose beads (Macherey-Nagel, Düren, Germany) from which were eluted by the addition of 50 mM reduced L-glutathione (dissolved in 25 mM Tris-HCl pH 8).
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Read length was assessed by DNA agarose gel electrophoresis (1% w/v) and amplicons were purified from the PCR mix using a NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel, Düren, DE) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... purified with the NucleoSpin® tissue kit (Macherey-Nagel, Düren), digested ...
-
bioRxiv - Microbiology 2023Quote: ... or NucleoSpin®RNA (MACHEREY-NAGEL, Duren, Germany) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA was isolated from AW-EVs or ML-EVs pellets using NucleoSpin® miRNA (MACHEREY-NAGEL, Duren, Germany). The small RNA library was prepared using NEBNext Small RNA Library Prep Set for Illumina (New England Biolaps ...
-
bioRxiv - Molecular Biology 2023Quote: All plasmids were purified using the Endotoxin-free plasmid DNA purification kit (Macherey-Nagel), the total volume was adjusted to 10% (ml ...
-
The CB1 receptor interacts with cereblon and drives cereblon deficiency-associated memory shortfallsbioRxiv - Neuroscience 2023Quote: RNA isolation for multiple tissues was achieved by using the NucleoZOL one phase RNA purification kit (Macherey-Nagel #740404.200) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The genomic DNA extraction was done using the NucleoSpin Microbial DNA kit (Macherey-Nagel), and the genomic libraries were constructed using Nextera paired-end library ...
-
bioRxiv - Genomics 2023Quote: High-molecular-weight DNA was extracted by using Nu-cleoBond HMW DNA (MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany) in accordance with the following manufacturers’ protocols ...
-
bioRxiv - Genetics 2023Quote: ... the DNA was purified with NucleoMag P-beads (Macherey-Nagel, Düren, Germany). A second round of digestion was performed with 50 U of DpnII or Csp6I RE (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... NucleoBond AXG 20 columns and NucleoBond buffer kit were purchased from Macherey-Nagel (Bethlehem, PA). Nanosep Centrifugal Devices (MWCO 3K ...
-
bioRxiv - Genomics 2023Quote: ... and purified using NucleoMag™ NGS magnetic beads (Macherey-Nagel, Düren, Germany) prior to DNA libraries synthesis.
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel). The sgRNA loci were amplified with an indexing 5′ primer (5′-aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacNNNNNN gcacaaaaggaaactcaccct ...
-
bioRxiv - Genetics 2023Quote: ... The amplicon was purified using the PCR clean-up and gel extraction kit (Macherey-Nagel) and Sanger sequenced using the forward primer ...