Labshake search
Citations for New England Biolabs :
4651 - 4700 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... (R0176, New England Biolabs). E ...
-
bioRxiv - Cell Biology 2024Quote: ... we microinjected 5 ng/μl Pmyo-3::GFP and 95 ng/μl of 2-Log DNA ladder (New England BioLabs) into the germline of GRD-3::mKate2 animals to generate transgenics expressing a muscle-specific GFP marker.
-
bioRxiv - Cell Biology 2024Quote: ... which were generated via PCR using the Q5 DNA Polymerase (New England BioLabs), purified with HighPrep PCR Clean-up beads (MagBio) ...
-
bioRxiv - Cell Biology 2024Quote: ... Both PCR and qPCR were performed using Pfusion High-Fidelity Polymerase Master Mix (NEB) and full-length Solexa P3/5 primers ...
-
bioRxiv - Cell Biology 2024Quote: ... pFUW was linearized using NheI-HF (NEB R3131) and BamHI-HF (NEB R3136 ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmid DNA was linearized using AgeI restriction enzyme (New England Biolabs) then Poly A Tail was introduced using PCR (Table S11) ...
-
bioRxiv - Cell Biology 2024Quote: ... Ligation of pBluescript II KS (+) and ORF was performed using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: The deadenylase dead mutation (D1020A) in PAN2’s coding sequence was generated by site-directed mutagenesis (Q5 Site Directed Mutagenesis Kit from NEB E0554) with primer pairs 5’ GGTTTGAATAATGCCTTCAAACACATTAATATTAATGTC 3’ and 5’ ATGACCAACAAATACATTATTCAAACCATGACCAAC 3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... The vector backbone was also PCR-amplified and the three fragments were assembled with NEBuilder HiFi DNA assembly kit (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... Coli (NEB), purified using the Zyppy Plasmid Miniprep Kit (Zymo) ...
-
bioRxiv - Genomics 2024Quote: ... The plasmid was digested with Esp3I (NEB), while the PCR amplicon was digested with BsaI (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... cloning was performed using PCR of desired insert fragments with Q5 (New England Biolabs (NEB)) ...
-
bioRxiv - Genetics 2024Quote: ... the proteinase K (NEB) was added and incubated for 2 h at 55 °C to digest protein and the RNase A (Thermo ...
-
bioRxiv - Genetics 2024Quote: ... the left and right homology arms were amplified by pfusion PCR (NEB) using y w genomic DNA as template and primer pairs Ti897/898 and Ti899/900 ...
-
bioRxiv - Genetics 2024Quote: ... TLK1 and TLK2 point mutants were generated by site-directed mutagenesis reactions using the NEB Q5 site-directed mutagenesis kit (NEB, E0554S). Primers are listed in Supplementary Table 1.
-
bioRxiv - Genetics 2024Quote: ... and treated with CIP (New England BioLabs) to generate pJM10 ...
-
bioRxiv - Genetics 2024Quote: ... Each assay was prepared to contain a final concentration of 1× PrimeTime Master Mix (IDT) or 1× Luna Universal qPCR Master Mix (NEB), 0.1 μM for each of the two probes (LNA9K1-Gly ...
-
bioRxiv - Genetics 2024Quote: ... and SV40 polyA PCR products were assembled in pattB-w-using Gibson assembly (NEB). Act5C-sfGFP and 3xP3-sfGFP integrations into attP40 were recovered by BestGene ...
-
bioRxiv - Genetics 2024Quote: ... along with an additional 5 µL 2x Gibson Assembly Master Mix (NEB Cat#E2611L). The reaction mixture was incubated at 50°C for 1 hour ...
-
bioRxiv - Genetics 2024Quote: ... YCp50 was digested using restriction enzymes EcoRI-HF (NEB Cat#R3101S) and BspDI (NEB Cat#R0557S ...
-
bioRxiv - Genetics 2024Quote: ... and BspDI (NEB Cat#R0557S) with rCutSmart buffer ...
-
bioRxiv - Genetics 2024Quote: ... coli (NEB Cat#C2987I) and plated onto 10-cm LB-AMP plates (IPM Scientific Cat#11006-016 ...
-
bioRxiv - Genetics 2024Quote: ... ProtoScript II (NEB), and 1 μg of total RNA input.
-
bioRxiv - Immunology 2024Quote: ... 0.4 µl of 2000 U/ml Phusion® High-Fidelity DNA Polymerase (NEB, #M0530S), 2 µl of the universal forward primer (5’-AAGCAGTGGTATCAACGCAGAG-3’ ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and 200 µL of OneTaq HotStart 2X Master mix (NEB #M0484L). Three cycles of PCR was then carried out with the following steps:
-
bioRxiv - Evolutionary Biology 2024Quote: ... or Phusion HF DNA polymerase (NEB) expression analysis.
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR was carried out with One Taq DNA polymerase (NEB, cloning) using primers listed in Supplementary Table 5 and products cloned using the pGEM-T Easy Vector System I (Promega ...
-
bioRxiv - Developmental Biology 2024Quote: ... The libraries were amplified using NEB Next High- Fidelity 2X PCR Master Mix (NEB) with primer extension at 72°C for 5 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB) according to manufacturer’s directions ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by NEB NEBNext Ultra II (NEB #E7760) or Illumina TruSeq library preparation and Illumina platform sequencing ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 µl ExoI (NEB) and incubated for 1 h at 37°C followed by heat inactivation of 20 min at 80°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... BL21(DE3) (NEB) following the same transformation procedure described ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.05 μL of DraI enzyme (NEB, #R0129L), 0.1 μL of Hot Start Taq DNA Polymerase (NEB ...
-
bioRxiv - Immunology 2024Quote: ... 0.15 μL Enterokinase (BioLabs, Lot: 10153225, 16000 U/mL). 0.63 μL of Streptavidin FITC Conjugate (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... Exonuclease I (M0293S, NEB), FastAP Thermosensitive Alkaline Phosphatase (EF0651 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and RNase inhibitor (New England Biolabs) for 5 min on ice ...
-
bioRxiv - Microbiology 2024Quote: ... coli (New England Biolabs), which were plated and incubated at 37°C overnight on LB Agar Carbenicillin (100 µg/mL ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplified PCR products were digested using DpnI (NEB), the ends of the PCR fragments were then phosphorylated using T4 polynucleotide kinase (PNK ...
-
bioRxiv - Neuroscience 2024Quote: ... or 5 µL of O-Glycosidase (P0733L, NEB) where indicated prior to denaturation/loading on SDS-PAGE gels according to manufacturer protocols ...
-
bioRxiv - Cell Biology 2024Quote: ... dynein-bound beads were mixed with 5 μM SNAP-Cell-TMR or SNAP-AlexaFluor-647 (New England Biolabs) for 10 minutes at room temperature.
-
bioRxiv - Cancer Biology 2024Quote: ... and BamHI-HF (New England Biolabs). Digested DNA was purified using a GeneJet PCR purification kit.
-
bioRxiv - Cancer Biology 2024Quote: ... 500 uL of warm SOC outgrowth medium (New England Biolabs #B9020S) was added to the tubes and the mixture was incubated overnight at 37°C and 220 rpm agitation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Coli (NEB, #C3040H) and constructs were purified using the manufacture’s instruction of the MIDI-Prep system (Macherey-Nagel ...
-
bioRxiv - Genetics 2024Quote: ... 1998) was amplified by PCR and then inserted into the pBS vector using NEBuilder HiFi DNA Assembly Master Mix (NEB) to generate pBS-UASp ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli (catalog: C3029J; New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 ng of DNA for each sample was then used with the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) and completed according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... range 9.0-9.5] were converted into sequencing libraries with the “NEBNext Ultra II Directional RNA Library Prep Kit for Illumina” (#E7760, New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Exon 3 of Smad4 was amplified by PCR using the Q5 High Fidelity DNA polymerase (M0491S; NEB). Smad4 primers used were FWD ...
-
bioRxiv - Immunology 2024Quote: ... The T7 sgRNA PCR product (500 ng) was used as a template for in vitro transcription with the T7 High Yield RNA synthesis kit (NEB, cat # E2040S). The reaction was incubated at 37°C for 4 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... incubated with micrococcal nuclease (M0247S, Biolabs) at 37° for 10 min ...