Labshake search
Citations for New England Biolabs :
4801 - 4850 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: Site directed mutagenesis was performed using the Q5® Site-Directed Mutagenesis Kit according to the manufacturer’s instruction (New England BioLabs Inc. (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2024Quote: ... All sequences were inserted into L4440 using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into DH5α bacteria.
-
bioRxiv - Cell Biology 2024Quote: ... Each 1 mL aliquot of microsomes was treated for 10 min at 37°C with 4000 U micrococcal nuclease (New England Biolabs), 2 U RNase-free DNase (Promega) ...
-
bioRxiv - Cell Biology 2024Quote: ... 25% of the sample was used for Endo H (New England Biolabs) treatment following manufacturer protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR product using T7 RNA polymerase (NEB, M0251L) as described previously 18 ...
-
bioRxiv - Cell Biology 2024Quote: ... then 1 μL Endo H and 2.5 μL GlycoBuffer 3 (New England Biolabs) was added and incubated for 1 hour at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Individually barcoded strand-specific libraries for mRNA sequencing were prepared from total RNA samples of high quality (approximately 150 ng per sample) using the NEBNext® RNA Ultra II Directional RNA Library Prep Kit (New England Biolabs) for 12 PCR cycles on the liquid handler Biomek i7 (Beckman Coulter GmbH ...
-
bioRxiv - Cell Biology 2024Quote: ... for neuron infection using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs). iPSC-derived neurons were infected using viral particles diluted in N2B27 media (5 MOI ...
-
bioRxiv - Plant Biology 2024Quote: ... including restriction digestion of the backbone vectors followed by ligation with T4 DNA ligase (Nippon Gene, Japan) or the Gibson assembly reaction with Gibson Assembly Master Mix (New England Biolabs Japan, E2611) (Supplementary Table S1) ...
-
bioRxiv - Plant Biology 2024Quote: ... we used NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). pTA7002 was linearized using XhoI and SpeI restriction enzymes (New England Biolabs) ...
-
bioRxiv - Plant Biology 2024Quote: ... pTA7002 was linearized using XhoI and SpeI restriction enzymes (New England Biolabs). GmBCAT1 was PCR amplified with terminal extensions complementary to the resulting pTA7002 ends ...
-
bioRxiv - Microbiology 2024Quote: ... and Phusion DNA polymerase (New England BioLabs). Templates for RNA used in aminoacylation assays were amplified using reverse primers containing two 5′-terminal 2′-O-methyl modified bases to ensure the correct 3′ end of the RNA ...
-
bioRxiv - Microbiology 2024Quote: ... Digested products were cleaned using Monarch® PCR & DNA Cleanup Kit (NEB) and incubated with T4 DNA ligase (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... cenocepacia K56-2 genome using Q5 polymerase with high GC buffer (NEB) and primers 3107 and 3108 (Supplementary Table 10 ...
-
bioRxiv - Microbiology 2024Quote: ... Resultant primers were used for PCR with Q5 DNA polymerase with high-GC buffer (NEB). For CRISPRi-Seq ...
-
Recruitment of the m6A/Am demethylase FTO to target RNAs by the telomeric zinc finger protein ZBTB48bioRxiv - Molecular Biology 2024Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L). Protein-RNA complexes were separated using 4–12% BisTris–PAGE and transferred to a nitrocellulose membrane (Protran) ...
-
bioRxiv - Synthetic Biology 2024Quote: Our cloning strategy was based on Golden Gate assembly using appropriate spacer and BsaI-HFv2 (NEB) and BbsI-HF (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Enzymes for Golden Gate assembly were purchased from New England Biolabs (NEB, Ipswich, MA, USA). PCR were performed using 2X Q5 PCR master mix (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid extraction and DNA purification were performed using Monarch kits (NEB). Sequences were verified with Sanger sequencing by Azenta Life Sciences or Primordium Labs for whole plasmid sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... Diluted supernatants were used as the template DNA (5 μL) for qPCR using a 2×Luna universal qPCR master mix (New England BioLabs), with 0.5 μM of primers ...
-
bioRxiv - Genomics 2024Quote: ... Library preparation was conducted with NEBNext Library Prep Master Mix Set for Illumina (New England Biolabs) with NEBNext Multiplex Oligos for Illumina (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: ... RNA was purified with Ambion MEGAclear spin columns and then treated with Antarctic Phosphatase (New England Biolabs) for 30 min at 37 °C to remove residual 5′-phosphates ...
-
bioRxiv - Immunology 2024Quote: ... A custom ribonucleoside blend was used comprising 3′-O-Me-m7G(5′)ppp(5′)G cap analog (New England Biolabs), ATP ...
-
bioRxiv - Physiology 2024Quote: ... for site-directed mutagenesis to generate nonsense mutations in mouse Mypbhl using Q5 Hot Start High-Fidelity (New England Biolabs, Cat No: M0494S). Plasmids were sequenced by Sanger reaction (Azenta Life Sciences ...
-
bioRxiv - Immunology 2024Quote: ... 2 uL of Rapid PNGase F Buffer (NEB) was added and incubated at 80°C for 3 minutes ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... or Q5 (New England Biolabs #M0491) DNA polymerase was used for PCR according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... 30 U of phi29 DNA polymerase enzyme (New England Biolabs), 1× phi29 buffer (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: ... we performed an A-tailing of the PCR products of the YTS191-light chain cDNA by adding 5 µl of 10X ThermoPol Buffer (NEB, B9004), 10 µl of 10 mM ATP ...
-
bioRxiv - Genomics 2024Quote: dam enzyme (NEB, Cat# M0222S) was used according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... IVT was performed following the manufacturer’s protocol for the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA, USA). Polyadenylated RNA was added to the IVT RNA control at a ratio of 1:1000.
-
bioRxiv - Microbiology 2024Quote: ... and cleaned with the Monarch RNA Cleanup Kit (NEB, Ipswich, MA, USA). Ribosomal 23S and 16S samples were prepared by amplifying the appropriate sequences from genomic E ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR product was used as the template for IVT with the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA, USA). Samples were then treated with DNase I and cleaned with the Monarch RNA Cleanup Kit (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... DNA fragmentation was performed using the NEBNext® Ultra™ II FS DNA Library Prep Kit (New England Biolabs), an enzymatic fragmentation assay with an average fragment size of 380 bp ...
-
bioRxiv - Genomics 2024Quote: ... The single-strandedness of the DNA oligos on the beads was restored by incubating the beads with a lambda exonuclease mix (NEB M0262L) for 30 minutes at 37° C ...
-
bioRxiv - Cancer Biology 2024Quote: ... made up of 1 uL DNA Ladder (New England Biolabs, N3231L), 1 µL Purple Dye (New England Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 µL of PCR product was digested by 1μL of DpnI (NEB) for 2 hours ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA was capped using the Vaccinia Capping System (NEB, M2080S), desalted on P30 columns ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting PCR products were cloned via Gibson assembly60 in pBEL1784 previously digested with EcoRI-HF and NotI-HF (New England Biolabs). In addition ...
-
bioRxiv - Microbiology 2024Quote: ... and the colonies were screened for the insert of a right size with the primers pMRB-PlacGFP_ins_1_F and pMRB-PlacGFP_ins_1_R using Phusion polymerase (NEB, Phusion High Fidelity DNA Pol, M0530L) polymerase for the insert longer than 5kb (PCR thermocycling conditions were as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were then prepared using the NEBNext Ultra II DNA library Prep Kit for Illumina (NEB, cat# E7645S). Two replicates were performed for each condition ...
-
bioRxiv - Microbiology 2024Quote: ... The initial dephosphorylation reaction was in a mixture (50 μL) containing 5 μL of terminal transferase buffer (NEB Tdt Reaction Buffer, Catalog # M0315S), 1 μL of shrimp alkaline phosphatase (rSAP ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μL of shrimp alkaline phosphatase (rSAP, NEB Catalog # M0371S), and 10 μg of fragmented DNA ...
-
bioRxiv - Microbiology 2024Quote: ... The colonies were screened for insert using Check1_ins_pSW_for and Check1_ins_pSW_rev primers from Supplementary Data 7 using Phusion polymerase (NEB, Phusion High Fidelity DNA Pol, M0530L) polymerase for inserts >5kb (PCR thermocycling conditions were as follows ...
-
bioRxiv - Microbiology 2024Quote: ... and 1/10th volume of DNAse I reaction buffer (NEB cat. no. B0303S) were added to 1 mL of phage lysate and incubated at 37°C for 30 min followed by a 60 min incubation at 65°C ...
-
bioRxiv - Genetics 2024Quote: ... The products were treated with exonuclease I (New England Biolabs) and rapid alkaline phosphatase (Roche Diagnostics ...
-
bioRxiv - Microbiology 2024Quote: A NEBNext® Ultra™ II DNA Library Prep Kit (New England Biolabs, cat. no. E7645S) protocol for Illumina was used to prepare DNA libraries for sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... 25 pmol of the ss-DNA library was formed duplex and amplified using Phusion High-Fidelity DNA Polymerase™ (NEB), according to the manufacturer’s recommended protocol with 0.5 uM Primer 1 (CCTAATACGACTCACTATAGGGTTAACTTTAAGAAGGAGATACATATATG ...
-
bioRxiv - Biochemistry 2024Quote: A Q5 Site-directed Mutagenesis Kit (New England Biolabs) was used per the manufacturer’s instructions with the primers in Table S1 and a pET15b-holC plasmid to mutate arginine 128 to alanine in the HolC protein ...
-
bioRxiv - Biochemistry 2024Quote: ... scRNA was prepared by T4 RNA ligase 1 ligation (NEB) exactly as described in ref. ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 ng of the PCR product was used in an in vitro transcription reaction using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, E2040S). The DNA template was digested through addition of DNase I after in vitro transcription ...