Labshake search
Citations for New England Biolabs :
4901 - 4950 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... coli Shuffle T7 cells (New England Biolabs, MA, USA) were transformed with the pHMGWA-MaBP-Nb constructs ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA digestion was performed with DNase I and RNA was reverse-transcribed into cDNA using LunaScriptTM RT SuperMix kit (New England Biolabs, Cat#E3010L). qPCR was performed using the StepOnePlusTM Real-Time PCR System with SYBR green as the detection method ...
-
bioRxiv - Bioengineering 2024Quote: ... coli (New England Biolabs Inc., Catalog # C3020K). These cells were incubated overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... or ubi4-REE-act1(till the stop codon) was generated using pcr from plasmids containing these sequences using the following primers and Phusion polymerase (New England Biolabs: M0530S) (F:AATCAACGGCTTCATACCACCTCAGCCAGCCGTGT TATAACTTACCGTTTACCAACTACATTTTTTGTAACG AACCAAAAAACCCTCAAAAGACAAGACCATGCAGA TTTTCGTCAAGAC R ...
-
bioRxiv - Biochemistry 2024Quote: ... purified complexes were treated with Lambda phosphatase (NEB) at a concentration of 5 µL per ml protein sample for a period of 2 hours at 16 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... Of the rRNA-depleted samples directional libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) in accordance to the recommended protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... incubated for 2 hours at 30 ° C and stopped by addition of 0.2 U apyrase (NEB), incubated at 30 ° C for 20 mins ...
-
bioRxiv - Bioengineering 2024Quote: ... were mixed in molar ratio 1:1 and 0.37 pmol of total DNA was then treated by Gibson Assembly Master Mix (New England Biolabs) for 3 hours at 50°C ...
-
bioRxiv - Biochemistry 2024Quote: ... between the SalI and XbaI restriction sites using HiFi DNA Assembly Mix (NEB). Point mutations (K119R ...
-
bioRxiv - Biochemistry 2024Quote: ... end radiolabeled with 32P using T4-polynucleotide kinase (NEB, Cat#M0201) and [γ-32P] ATP ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL SUPERase•In RNase Inhibitor and 1 µL T4 RNA Ligase 2 truncated KQ (NEB, M0373L) were added to the RNA-adapter mixture ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL 5′-deadenylase (NEB, M0331S) was added into each ligation mixture by incubation at 30 °C for 1hour followed by adding 1 µL RecJf (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... The Omp25 substrates were generated by gene synthesis (Azenta) and cloned into the PURExpress DHFR Control Vector (NEB) between the NdeI and NotI sites ...
-
bioRxiv - Bioengineering 2024Quote: ... Reactions were incubated at 16°C for 16 hours and purified with Monarch® RNA Cleanup Kits (New England Biolabs, Cat# T2030) according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... For Golden Gate assembly BsaI HF-v2 enzyme (NEB) and T4-DNA Ligase (1u/µl ...
-
bioRxiv - Biochemistry 2024Quote: ... The concentration of adapter-labelled DNA fragments in each sample was measured via qPCR using NEBNext® Library Quant Kit for Illumina® (NEB). The samples were then pooled together to an equimolar concentration and checked on a Tapestation (Agilent).
-
bioRxiv - Biochemistry 2024Quote: ... and NEBNext® Multiplex Oligos for Illumina® were purchased from NEB and stored at −20°C.
-
bioRxiv - Biochemistry 2024Quote: ... 1-5 mL of cell pellet was harvested for plasmid extraction with the Monarch Plasmid DNA Miniprep Kit (New England Biolabs) (T1010) ...
-
bioRxiv - Biochemistry 2024Quote: ... and Nitrofurazone (NFZ, Fluka, PHR1196) and rNTPs (New England Biolabs, N0450S).
-
bioRxiv - Biochemistry 2024Quote: All protein mutagenesis was performed with the Q5 site-directed mutagenesis kit from NEB (E0554). Primers were designed with the NEBaseChanger tool (https://nebasechanger.neb.com/ ...
-
bioRxiv - Biochemistry 2024Quote: ... 9 mU/μL Escherichia coli RNA polymerase holoenzyme (NEB), 10 μM rNTPs (Sigma) ...
-
bioRxiv - Biochemistry 2024Quote: ... Phusion High-Fidelity DNA polymerase (M0530L, NEB), Pico PLUS chemiluminescent substrate (PI34577 ...
-
bioRxiv - Biochemistry 2024Quote: ... Product of the isothermal assembly reaction was transformed into NEB Stable cells (C3040H, NEB). Transformed cells were plated on 1.5% agar plates with LB media (10 g/l tryptone ...
-
bioRxiv - Biochemistry 2024Quote: PCR inserts were amplified with Phusion High-Fidelity DNA Polymerase (M0530L, NEB). Amplification primers were designed with a 30 bp overlap with the linear ends of restriction-digested vectors ...
-
bioRxiv - Biochemistry 2024Quote: ... the DNA template was removed by DNase I (NEB) digestion and the RNA transcripts were purified by the RNA Transcript Purification Kit (NEB ...
-
bioRxiv - Biochemistry 2024Quote: PCR was employed to prepare linearized DNA based on primers pDL-631 and pDL-3431 using Q5 Hot start PCR polymerase (NEB). All the components were mixed well and incubated in a thermal cycler (Biorad ...
-
bioRxiv - Biochemistry 2024Quote: ... Linearized vectors were dephosphorylated using calf intestinal phosphatase (M0290S, NEB). All inserts and vectors were purified using 0.9% agarose gel prior to isothermal assembly (D4002 ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmids with various mutations were generated by PCR methods using Q5® Site-Directed Mutagenesis Kit (NEB) according to the instructions and verified by Sangon ...
-
bioRxiv - Biochemistry 2024Quote: ... The transcription process was driven by T7 polymerase using HiScribe T7 High Yield RNA Synthesis Kit (NEB). After 2h transcription ...
-
bioRxiv - Biochemistry 2024Quote: ... Taq DNA ligase (M0208L, NEB), Tris(2-carboxyethyl)phosphine hydrochloride (TCEP ...
-
bioRxiv - Biochemistry 2024Quote: ... digestion and the RNA transcripts were purified by the RNA Transcript Purification Kit (NEB) and dissolved in RNase-free double-distilled H2O.
-
bioRxiv - Biochemistry 2024Quote: ... reactions were performed with 6 μl of PURExpress in vitro protein synthesis system (New England Biolabs). The reactions were carried out on different templates (Supplementary Table 2) ...
-
bioRxiv - Biochemistry 2024Quote: PamB2-ribosome complexes were generated by in vitro transcription-translation reactions in PURExpress in vitro protein synthesis system (New England Biolabs) with the same reaction mix as described earlier in the toeprinting assays ...
-
bioRxiv - Biochemistry 2024Quote: ... unlabeled RNAs were dephosphorylated at the 5’-end by treating with calf intestinal alkaline phosphatase (CIP, New England Biolabs) for one hour at 37 °C ...
-
bioRxiv - Biophysics 2024Quote: ... followed by 1h DpnI (NEB) treatment at 37°C plus inactivation at 80°C for 20 minutes (1 μL enzyme per 50 μL PCR reaction) ...
-
bioRxiv - Biophysics 2024Quote: ... and purified from NEB 10-beta Competent E ...
-
bioRxiv - Biophysics 2024Quote: ... Plasmid DNA was extracted using the Qiagen Plasmid Plus Midi kit and the library inserts were obtained through double endonuclease digestion (HindIII-HF and NheI-HF, NEB) followed by agarose gel purification achieved by a combined use of centrifugal filter units (Millipore ...
-
bioRxiv - Bioengineering 2024Quote: ... Plasmids were digested with ClaI (New England Biolabs) and BamHI (New England Biolabs ...
-
bioRxiv - Biophysics 2024Quote: ... coli C3020 cells (NEB, Ipswich, MA, US). The number of transformants was assessed by colony count in serial dilutions of transformation outgrowth aliquots in LB plates supplemented with 50 μg/mL spectinomycin ...
-
bioRxiv - Biophysics 2024Quote: ... Quick CIP-trated (NEB) pGJJ162 (abundancePCA ...
-
bioRxiv - Bioengineering 2024Quote: ... Gibson assembly reactions were carried out with the NEBuilder Hifi DNA Assembly Master Mix (E2621, NEB) following supplier instructions ...
-
bioRxiv - Biophysics 2024Quote: ... coli cells (NEB) and individual colonies were used to inoculate 50 mL overnight LB cultures grown at 37°C ...
-
bioRxiv - Biophysics 2024Quote: ... coli 10-beta cells (NEB). Instead ...
-
bioRxiv - Biochemistry 2024Quote: 1μl of total cellular RNA was used for sequencing library generation by NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA, Catalog #: E7530L) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Biochemistry 2024Quote: ... Then 3 µL USER Enzyme (NEB, USA) was used with size selected ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmids were transformed into BL21(DE3) (NEB) and 30 mL of single-colony culture was grown in Terrific Broth II (MP Biomedical ...
-
bioRxiv - Neuroscience 2024Quote: ... The following PCR mixture was prepared for both preliminary and preparative PCR: Hot Start Taq DNA polymerase (2.75 U, New England Biolabs), 1X Hot Start Taq reaction buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli DNA Polymerase I (NEB #M0209L). For Nick translation the nicking endonuclease Nt.CviPII was excluded ...
-
bioRxiv - Neuroscience 2024Quote: ... NEBNext Ultra II Q5 Master Mix (New England Biolabs, M0544). The resulting PCR products were purified through double-sided AMPure XP beads cleanup (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was amplified using the Taq DNA polymerase with ThermoPol®-Buffer (New England Biolabs, Ipswich, USA). Briefly ...