Labshake search
Citations for New England Biolabs :
4501 - 4550 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... and amplified with 14 cycles of PCR using LongAmp Taq Master Mix (New England Biolabs, UK). cDNA was quantified using the Qubit DNA High sensitivity assay (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: ... Supplementary Table 1) using a modified protocol of the NEBNext Single Cell/Low Input cDNA Synthesis & Amplification Module (New England Biolabs, UK) (Supplementary Methods and Supplementary Table 18 ...
-
bioRxiv - Genomics 2024Quote: ... clone C36B11 (NEB, 9733S) was used at 1:200 dilution ...
-
bioRxiv - Genomics 2024Quote: ... 2 mg/mL temperature labile proteinase K (NEB, P8111S), and 12.5 mM MgCl2 for RNA fragmentation) ...
-
bioRxiv - Genomics 2024Quote: ... 1 μL T4 RNA ligase reaction buffer (NEB), 1 μL RNAseOUT (Invitrogen) ...
-
bioRxiv - Genomics 2024Quote: ... 30 μg per replicate of poly-adenylated mRNA was isolated using oligo d(T) beads (NEB E7490L). Resulting mRNA was split into 6 separate reactions and cDNA was synthesized using a gene-specific primer (5’-CTCATCAATGTATCTTATCATGTCTG-3’ ...
-
bioRxiv - Genomics 2024Quote: ... DNA was digested into single nucleosides by using the Nucleoside Digestion Mix (New England Biolabs) enzyme cocktail at 37°C for 2 h ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Genomic libraries were prepared with NEBNext Ultra II FS DNA Library Prep with Beads (New England Biolabs), with single indexes ...
-
bioRxiv - Neuroscience 2024Quote: ... linearized with XbaI (NEB) and purified via DNA extraction kit (ELPIS) ...
-
bioRxiv - Genomics 2024Quote: ... treated with USER enzyme (NEB) and amplified by PCR with barcoded universal primers NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 50uL reactions were prepared using 1x Q5 Hotstart Master mix (NEB M0494S), 0.5uM Forward primer ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 µl of Golden Gate Enzyme Mix (BsaI-HFv2, NEB M2616AA), and adding dH2O to reach a total volume of 20 µl ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 μL of T4 DNA ligase (NEB) were added and incubated at RT for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... 1x Phusion GC buffer (NEB), 0.2 mM dNTPs ...
-
bioRxiv - Genomics 2024Quote: ... T4 PNK (NEB # M0201) and Klenow DNA Polymerase (NEB # M0210) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1% (v/v) BSA (20 mg/ml, NEB, B9000S) + 5μL of hash oligo (10 uM ...
-
bioRxiv - Microbiology 2024Quote: ... 20 U of DpnI (New England Biolabs : R0176S) was added to the PCR products and incubated at 37 °C for 1 hour to remove the parental PCR DNA template ...
-
bioRxiv - Microbiology 2024Quote: pRS31N-Barcode was digested with NdeI (NEB : R0111S) for 2 hours at 37°C and inactivated for 20 minutes at 65°C:
-
bioRxiv - Molecular Biology 2024Quote: ... using the Quick Ligase kit (M2200, NEB, Ipswich, US). For a site-directed mutagenesis the central guanine of the seed sequence was exchanged for an adenosine ...
-
bioRxiv - Pathology 2024Quote: Sequencing library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs, MA). cDNA libraries were sequenced by a NovaSeq 6000 (Illumina ...
-
bioRxiv - Systems Biology 2024Quote: ... Vectors were digested using restriction enzymes (EcoRI and BamHI) and PCR fragments were amplified using Q5 DNA polymerase (NEB). NES-APEX2 ...
-
bioRxiv - Systems Biology 2024Quote: ... and A-tailed using Klenow HC 3′ → 5′ exo (#M0212L; NEB).
-
bioRxiv - Systems Biology 2024Quote: ... Barcodes were digested overnight with 80 units of NheI (#R0131S; NEB) and purified by magnetic bead purification (#CPCR-0050 ...
-
bioRxiv - Systems Biology 2024Quote: ... Linear barcoded vectors were purified by magnetic beads and digested for 3h with 40 units of XcmI (#R0533S; NEB). Finally barcoded vectors were purified again by gel-purification.
-
bioRxiv - Systems Biology 2024Quote: ... each library was digested overnight with I-CeuI (#R0699S, NEB), barcode-insert fragments were then circularized ...
-
bioRxiv - Systems Biology 2024Quote: Each of the selected eight promoters were amplified by PCR and individually inserted by Gibson assembly (#E2611S; New England Biolabs) into the reporter vector ...
-
bioRxiv - Plant Biology 2024Quote: ... and Amylose Resin (New England Biolabs, Ipswich, MA, USA) affinity chromatography ...
-
bioRxiv - Cell Biology 2024Quote: ... Library preparation was carried out by the Edinburgh Clinical Research Facility from 500 ng of each RNA sample using the NEBNext Ultra II Directional RNA library kit with PolyA enrichment module (New England Biolabs). Libraries were assessed for quality and fragment size using the Agilent Bioanalyser ...
-
bioRxiv - Cell Biology 2024Quote: ... Coli (NEB C3013I). Fresh bacterial colonies were inoculated into LB media containing ampicillin and grown overnight at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Doxycycline inducible CCDC134 constructs were cloned by PCR amplification followed by Gibson assembly (New England Biolabs) into pLenti-TRE- rtta3G-BLAST.
-
bioRxiv - Cell Biology 2024Quote: ... For template plasmids the following fragments were joined by Gibson assembly (NEBuilder HiFi DNA assembly®, NEB): pUC19*EcorI (NEB) ...
-
bioRxiv - Cell Biology 2024Quote: RNA encoding indicated HSP90B1 nascent chains were prepared from PCR amplified and purified DNA template containing a T7 promoter and carried out at 37°C for 2 hours using the HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using the RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Bioengineering 2024Quote: ... both from NEB and all work in E ...
-
bioRxiv - Cell Biology 2024Quote: ... and NdeI (60U, NEB, R011S). 20 ng of cut DNA was ligated to the 42-mer and 11-mer as described previously (66) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μl Hot Start High-Fidelity 2× Master Mix (M0494S; NEB) and nuclease-free water to fill up to 10 μl ...
-
bioRxiv - Genomics 2024Quote: ... The 3 library pools were purified by an ExoSAPII (NEB) reaction to remove single-stranded DNA and further by column purification (MiniElute Gel Extraction Kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... sample was washed with 1x T4 ligase buffer (NEB) (2,500 xg ...
-
bioRxiv - Cell Biology 2024Quote: ... was inserted into murine Shh between amino acids 92N and 93T (corresponding to N91 and T92 in human Shh) by using Gibson assembly (HiFi Assembly Kit, NEB). Where indicated ...
-
bioRxiv - Biochemistry 2024Quote: PNGase F (New England Biolabs) was used to remove N-glycan moieties from proteins under denaturing conditions according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2024Quote: ... in a black-bottomed 96-well plate and gene-specific LA qPCR assays were performed as described earlier18,19,20,27,47,48 using Long Amp Taq DNA Polymerase (New England BioLabs). Three transcribed (HPRT ...
-
bioRxiv - Microbiology 2024Quote: ... Here amplicons were incubated with T4 polynucleotide kinase (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli (catalog: C3019; New England Biolabs) were transformed with the Myc-DDK-tagged CPT1a transcript variant 1 (catalog ...
-
bioRxiv - Cell Biology 2024Quote: ... The Color Protein Standard Broad Range (10–250 kDa) (New England BioLabs Inc.) was used as protein molecular weight ladder ...
-
bioRxiv - Developmental Biology 2024Quote: ... All amplicons were subcloned into pCS2+ vector via FseI/AscI restriction sites or using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, #E2621S). The plasmids containing tp63.S and hoxd1.S were linearized using NotI ...
-
bioRxiv - Cell Biology 2024Quote: Plasmid with the requisite gene sequence was linearized using not1 or hind III (New England Biolabs) restriction enzyme and was used as template ...
-
bioRxiv - Cell Biology 2024Quote: ... The concentration of RNA was assessed by comparing the known nucleic acid concentrations of the DNA ladder bands (NEB, N3232L). Microinjection protocol was followed as mentioned previously 19 using Nanoject II injector (Drummond Scientific Company ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli (catalog: C3019; New England Biolabs) and selected for ampicillin resistance according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... using BbsI-HF (New England Biolabs). The sgRNA target sequences used were TCATCACATCGTGCAGAAGT and ATACAAGCAGGGCCAAATTG for the knockout of integrin β1 ...
-
bioRxiv - Genomics 2024Quote: All adapter-ligated amplicons were amplified with custom iTru5 and iTru7 index primers (Glenn et al. 2019) with NEBNext Ultra II Q5 Master Mix (NEB, Cat No, M0544, Ipswich, MA) according to reaction conditions described in Supplemental Table 6 ...
-
bioRxiv - Genomics 2024Quote: ... 1× phi29 buffer (New England Biolabs), 4 mM deoxynucleoside triphosphates (Invitrogen) ...