Labshake search
Citations for New England Biolabs :
4401 - 4450 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (NEB) was transformed with the final pET28a constructs ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 2 µl of Gel loading dye without SDS (NEB, Ipswich, MA) were added to each reaction ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Control plasmid was the PURExpress Control DHFR Plasmid (NEB, Ipswich, MA USA) with no fluorescent tag ...
-
bioRxiv - Synthetic Biology 2024Quote: ... transformed into NEB 10-beta electrocompetent cells (NEB C3020K), and extracted using the Qiagen Plasmid Maxi Kit (Qiagen 12162) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... then inserted the library cassette into the digested pMPRA1 backbone using the NEBuilder HiFi DNA Assembly kit (NEB E2621). This intermediate plasmid was purified with Kapa Pure Beads (Roche KK8002) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Amplification products were gel extracted using the Monarch® DNA Gel Extraction Kit (NEB T1020).
-
bioRxiv - Synthetic Biology 2024Quote: ... Both libraries were assembled through inverse PCR (iPCR) on the pET23-KOD-Exo-(Supplementary Information S1 Table S2) plasmid in Q5 High-Fidelity DNA Polymerase (NEB) reactions of 28 cycles following the manufacturer’s standard protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli cells following the recommended High Efficiency Transformation Protocol (C2987, New England Biolabs) described by the commercial strain provider ...
-
bioRxiv - Systems Biology 2024Quote: ... RNAs were extracted using Qiagen RNeasyPlus Mini kit and RNA library preparation performed using NEBNext Ultra II DirecMonal RNA Library prep Kit (NEB, Lynn, MA) following the manufacturer’s protocols ...
-
bioRxiv - Systems Biology 2024Quote: ... Uracil-Specific Excision Reagent (NEB, USA) was used as previously described142.The reaction was run for 2h at 37°C and the resulting spatially barcoded cDNA libraries were collected and libraries prepared as described previously142 ...
-
bioRxiv - Microbiology 2024Quote: ... MBP fusion proteins were detected with a rabbit anti-MBP from NEB company 1:1000 followed by an incubation with a goat anti-rabbit HRP-conjugated (1:3000) ...
-
bioRxiv - Genomics 2024Quote: ... and final library amplification were performed using the NEBNext Enzymatic Methyl-seq Kit (New England BioLabs) for WGEM-seq libraries ...
-
bioRxiv - Genomics 2024Quote: ... Another round of PCR was conducted to prepare the library for sequencing using NEBNext Ultra II Q5 Master Mix (New England Biolabs, M0544L), forward primer P5 and reverse primer P7 ...
-
bioRxiv - Genomics 2024Quote: ... the cloned vector was cleaned using standard ethanol precipitation (Sambrook and Russell 2001) and electroporated into 50ul of NEB stable E.coli strain (NEB; C3040H) using 1ul of cloning material (Applied volts-2200V ...
-
bioRxiv - Genomics 2024Quote: ... truncated (NEB), 1 μL T4 RNA ligase reaction buffer (NEB) ...
-
bioRxiv - Immunology 2024Quote: ... The qRT-PCR assays was performed using Luna Universal qPCR Master Mix (New England BioLabs, Frankfurt, Germany) on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad Laboratories GmbH ...
-
bioRxiv - Genomics 2024Quote: ... at 65 ⁰C for 2 h followed by MspI treatment (NEB Ipswich, MA) at 37⁰C overnight ...
-
bioRxiv - Immunology 2024Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... The mix consisted of 1 µL Cas9 protein (BioLabs, M0369M), 1 µL Fast Green FCF dye (Sigma ...
-
bioRxiv - Bioengineering 2024Quote: ... WT and CD81-Snorkel-tag input EVs were labelled with CLIP-substrate (CLIP-SurfaceTM 647; Catalog #S9234, NEB and/or CLIP-SurfaceTM 488 ...
-
bioRxiv - Biochemistry 2024Quote: ... at NheI (NEB) and BamHI (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... DNA underwent repair utilizing the NEBNext Companion Module (New England Biolabs GmbH, GER). Subsequently ...
-
bioRxiv - Immunology 2024Quote: ... 10ng RNA was used to prepare libraries using Single Cell/Low Input RNA Library Prep Kit for Illumina (New England BioLabs). Libraries with different indexes were pooled and sequenced by an Illumina NovaSeq 6000 as paired-end reads extending 150 bases.
-
bioRxiv - Immunology 2024Quote: ... and poly-A enriched before library preparation using NEBNext Ultra II Directional RNA Library Prep Kit (NEB, USA). For each library ...
-
bioRxiv - Cell Biology 2024Quote: ... For endoglycosidase H (Endo H; P0702S, NE BioLabs) digestion experiments ...
-
bioRxiv - Cell Biology 2024Quote: ... and pCAH-mScarlet-C3 using KOD One PCR Master Mix (#KMM-101X5, TOYOBO) and NEBuilder HiFi DNA Assembly Master Mix (#E2621L, New England Biolabs), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nuclei were treated with 0.5% SDS followed by 1.25% Triton X-100 before digesting with 400 U MboI (NEB) for 4 hr ...
-
bioRxiv - Cancer Biology 2024Quote: ... and PCR enrichment were performed sequentially using the NEBNext Ultra™ II DNA Library Prep Kit for Illumina (NEB). Finally ...
-
bioRxiv - Genomics 2024Quote: ... The DNA was then purified using the Monarch PCR & DNA Cleanup Kit (NEB). The first-dimension electrophoresis was run in 0.7% agarose in 1xTBE buffer at 0.7 V/cm for 18h ...
-
bioRxiv - Microbiology 2024Quote: ... virions were incubated with 0.2 mg/mL Proteinase K (NEB #P8107S) in 120 µL PBS at 37°C for 30 min and washed with PBST buffer three times ...
-
bioRxiv - Systems Biology 2024Quote: ... 0.5 µl of Q5 DNA polymerase (New England Biolabs) and molecular biology grade water to a total volume of 50 µl ...
-
bioRxiv - Microbiology 2024Quote: ... 50 µL of Q5® High-Fidelity 2X Master Mix (NEB), 5 µL each of 10 µM primer P1 and P2 (ACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGGGCA GGCTGGGAAAT) ...
-
bioRxiv - Biophysics 2024Quote: ... Bisulfite-converted libraries were PCR-amplified and uniquely dual-indexed using NEBNext Multiplex Oligos for Illumina (NEB #E6440S) and the Kapa HiFi Uracil+ PCR system (Kapa #KK2801) ...
-
bioRxiv - Biophysics 2024Quote: ... adenylated DNA using NEBNext Ultra End Repair/dA-Tailing Module (NEB #7442L). Methylated adaptors (NEBNext Multiplex Oligos for Illumina ...
-
bioRxiv - Biophysics 2024Quote: ... The assembled mutated Src library constructs were transferred into the pGJJ133 and pTB198 plasmids using NheI-HindIII digestion (NEB) and overnight temperature cycling T4 ligation (NEB) ...
-
bioRxiv - Biophysics 2024Quote: ... and we cloned the KD fragment on pGJJ133 via restriction digestion and T4 ligation with NheI and HindIII (NEB), resulting in pTB109 ...
-
bioRxiv - Biophysics 2024Quote: ... and overnight temperature cycling T4 ligation (NEB), followed by dialysis ...
-
bioRxiv - Biophysics 2024Quote: ... Following KLD enzyme treatment (NEB #M0554S), XL-10 Gold ultracompetent cells (Agilent ...
-
bioRxiv - Biophysics 2024Quote: ... and the resulting plasmid was subjected to a round of site directed mutagenesis (NEB) with oTB215 and oTB216 to introduce a start codon at the beginning of the KD sequence ...
-
bioRxiv - Biophysics 2024Quote: ... PCR was performed using Q5 HotStart high fidelity master mix (New England Biolabs #M0494S). Following KLD enzyme treatment (NEB #M0554S) ...
-
bioRxiv - Biophysics 2024Quote: ... coli cells (New Englad Biolabs) and purified with QIAprep spin miniprep kits (Qiagen ...
-
bioRxiv - Biophysics 2024Quote: ... were incubated with 0.6 µL of anti-SNAP antibody (New England Biolabs, P9310S) in a total of 50 µL BRB80 buffer (80 mM PIPES-KOH pH 6.8 ...
-
bioRxiv - Biophysics 2024Quote: ... 650 µM of BG-NH2 (New England Biolabs, S9148) was added to the mixture ...
-
bioRxiv - Biophysics 2024Quote: ... Plasmid region corresponds to the 71-1184 amino acids of BimC and the modified vector was amplified and assembled with KLD Enzyme Mix Reaction (NEB) to generate the recombinant BimC(Δ1-70)-GFP construct ...
-
bioRxiv - Biophysics 2024Quote: ... The cDNA for CFTR in pGEMHE was linearized using Nhe I (New England Biolabs), transcribed in vitro (mMESSAGE mMACHINE T7 Transcription Kit ...
-
bioRxiv - Cancer Biology 2024Quote: ... or NEBaseChanger (New England Biolabs (NEB)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... was used for library preparation of total RNAs and Next small RNA Kit (New England Biolabs) for library preparation of microRNAs according to manufacturerś instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... or rabbit anti human HMGA2 (New England Biolabs), ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the sequencing library was generated using the NEBNext® Ultra™II Directional RNA Library Prep Kit (New England Biolabs, E7760). RNA-seq was performed on NovaSeq 6000 (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted with the NEB Monarch RNA miniprep kit (NEB cat. T2010S) following manufacturer’s manual with on-column DNA digestion ...