Labshake search
Citations for New England Biolabs :
4351 - 4400 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... with 1x GlycoBuffer 1 (NEB). Following incubation ...
-
bioRxiv - Physiology 2024Quote: ... The libraries for the Illumina sequencer (paired-end 150 bp) were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... downstream of the constitutive 35S promoter and upstream of the start codon of the GUS reporter using HiFi DNA assembly cloning kit (NEB E5520). Fragments of 35S promoter + vector backbone + GUS was amplified using forward primer ATGTTACGTCCTGTAGAAACCC and reverse primer GTCGACTCCAAATGAAATGAAC ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg of purified DNA template was used in the Hi-Scribe T7 transcription kit (NEB) at 37°C overnight (∼16 hr.) ...
-
bioRxiv - Molecular Biology 2024Quote: ... attB plasmid containing genes for tdMCP-protein fusions and a MS2-circRNA barcode were digested overnight at 37°C to remove existing barcode sequence (2 μg plasmid, 5 μL 10x CutSmart buffer, 2 μL BsrGI-HF (NEB cat#R3575S), nuclease-free water to 50uL) ...
-
bioRxiv - Molecular Biology 2024Quote: ... was digested by combining the following and incubating overnight at 37°C: 2 μg plasmid + 5 μL CutSmart buffer (10x) + 2 μL AflII (NEB cat# R0520S) + 2 μL BlpI (NEB cat# R0585S ...
-
bioRxiv - Molecular Biology 2024Quote: ... and NheI-HF (NEB cat# R3131S) then submitted to University of Washington PacBio Sequencing Services for further processing ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 μL recombinant shrimp alkaline phosphatase (NEB cat#M0371S) was added and incubated at 37°C for 2 hrs ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µL USER enzyme (NEB) were added to each sample and incubated at 37°C for 15 min and followed by a purification with 50 µL AMPure XP beads according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1x protease inhibitors) and incubated with 0.3 U/μl CIP (New England BioLabs) for 1 hour at room temperature prior to loading onto a gel.
-
bioRxiv - Molecular Biology 2024Quote: ... coli (NEB cat#C2987H) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All reactions were mixed to 22 µl including 10 U of HindIII-HF (NEB, Catalog #R3104L) and up to 2 µl of QuickExtract lysates ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Restriction enzymes were obtained from NEB, except for DNase I (Roche 4716728001) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Oligos were phosphorylated using T4 polynucleotide kinase (T4 PNK, NEB M0201S) in a reaction containing 1 µl of 100µM forward oligo ...
-
bioRxiv - Synthetic Biology 2024Quote: ... purchased from NEB, was served as the backbone for the all sgRNA delivery plasmids ...
-
bioRxiv - Zoology 2024Quote: ... The annealed dsRNAs (2.5 µg) were checked on 1.5% agarose gel by running them together with 2 µL of dsRNA ladder (NEB# N0363S, Germany) (Fig ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.0005 U/µL RNase H (NEB #M0297L), and 2.5 U/µL M-MuLV RT (NEB #M0253L ...
-
bioRxiv - Genetics 2024Quote: ... Plasmids from selected clones were digested with NdeI and BamHI (New England Biolabs) and the resulting insert gel purified as above and ligated into the modified pcAT7-Glo1 vector (a gift from Brenton Graveley ...
-
bioRxiv - Genetics 2024Quote: ... coli DH5α competent cells (New England Biolabs, C2988J). Plasmids or purified chromosomal DNA were transformed into B ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Duplexed oligonucleotides were ligated into dephosphorylated and BsmBI-digested pLB-Cas9 using the Quick Ligase kit (NEB M2200S) to generate transfer plasmid with RIPK1 guide sequence ...
-
bioRxiv - Genomics 2024Quote: ... Zirconium beads (3.0mm) in a bead beater were used to homogenize mosquitoes before proceeding with NEB Monarch Total RNA Miniprep Kit (NEB #T2010). The on-column DNase I treatment was performed during RNA extraction ...
-
bioRxiv - Biophysics 2024Quote: ... Mfel and Smal (New England Biolabs), respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... The resulting mixture was transformed into competent DH5α bacteria (NEB, C2987I), and the plasmid was amplified and purified using the Nucleobond Xtra Midi kit (Macherey-Nagel ...
-
bioRxiv - Biochemistry 2024Quote: ... using Qubit DNA HS kit (New England Biolabs, M0494S). The final RP libraries were single-end sequenced with a NextSeq2000 P2 system (Illumina) ...
-
bioRxiv - Cancer Biology 2024Quote: All the newly generated plasmids reported in this study were created by Gibson Assembly using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, E2621L) as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.2 mM dNTP (NEB®, #N0447L), 2.5 ng/µL forward primer ...
-
bioRxiv - Biochemistry 2024Quote: ... coli strain T7 Express lysY/Iq (New England Biolabs, Ipswich, MA, USA) and purified by Ni- ...
-
bioRxiv - Synthetic Biology 2024Quote: ... interORF and ORF2p were then assembled using Hifi Assembly mix (NEB) into pCMV vector with the CMV promoter region removed ...
-
bioRxiv - Microbiology 2024Quote: ... respectively) using T4 RNA Ligase 1 (New England Biolabs, USA; #M0204) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and BamHI-HF (NEB, #R3136L). All site directed mutagenesis was performed using the NEBuilder HiFi DNA Assembly Master Mix according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The RT reaction was diluted 2-fold with nuclease free water and 1 μl of the diluted mix was subjected to 5’ RACE PCR using Q5 polymerase (NEB) with a touchdown PCR protocol ...
-
bioRxiv - Microbiology 2024Quote: ... coli ER1821 cells harboring the additional plasmid pM.EsaBC4I (New England Biolabs, Frankfurt am Main, Germany) to evade restriction by the SuaI restriction system.
-
bioRxiv - Microbiology 2024Quote: ... 5’ phosphorylated using T4 polynucleotide kinase (New England Biolabs), ligated by the addition of T4 DNA ligase and transformed in E ...
-
bioRxiv - Molecular Biology 2024Quote: ... the promoter EF1α and human DGCR8 sequences were removed using the restriction enzymes FseI and BsBtI (NEB). After ligation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and dATPs (NEB, N0440S). Next ...
-
bioRxiv - Genetics 2024Quote: ... MSp508_MCS was digested with restriction enzymes AgeI-HF (NEB Cat#R3552S) and BstEII-HF (NEB Cat#R3162S) ...
-
bioRxiv - Immunology 2024Quote: ... and β-N-Acetylglucosaminidase S (NEB), or all three enzymes were performed overnight at 37 °C using 1 unit each of enzyme ...
-
bioRxiv - Genetics 2024Quote: Double-stranded RNA was in vitro transcribed from a PCR amplicon using T7 RNA Polymerase (New England BioLabs) (Extended Data Fig ...
-
bioRxiv - Genomics 2024Quote: ... PCR amplification with was Q5® High-Fidelity DNA Polymerase (New England Biolabs) with CFTR Exon 8 forward primer (5’-TTTCTGTTGGTGCTGATATTGCCTCAGGGTTCTTTGTGGTGT-3’ ...
-
bioRxiv - Genetics 2024Quote: Histone array PCR amplicons were incubated with PaqCI (NEB #R0745) for 1-3 hours at 37C and subsequently cleaned up with GeneJet PCR clean up kit (Thermo Scientific ...
-
bioRxiv - Genetics 2024Quote: ... and all PCR products were generated with Phusion® High-Fidelity DNA Polymerase (New England BioLabs) and purified using NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel) ...
-
bioRxiv - Microbiology 2024Quote: ... coli DH5α (NEB) is used for cloning and plasmid propagation ...
-
bioRxiv - Genetics 2024Quote: ... the remaining 25 µL of RNA was treated with dsDNAse (New England Biolabs Inc) for 30 minutes at 37° ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5 U of SplintR ligase (NEB, Ipswich, MA, USA), and 10 nmol ATP was added ...
-
bioRxiv - Microbiology 2024Quote: ... mRNA with intact poly(A) tails was enriched using the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB; # E7490L) and utilized for library constructions with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina along with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Microbiology 2024Quote: ... Fragments were purified using a gel agarose purification kit (NEB Monarch). Taq polymerase PCR with primers P7 and P8 ...
-
bioRxiv - Plant Biology 2024Quote: ... The RbcL_D86H plasmid was created by KLD site-directed mutagenesis (New England Biolabs) of the P-67 cpDNA EcoRI 14 plasmid (Chlamydomonas Resource Centre).
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmids were isolated using Monarch (NEB) or PureYield (Promega ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli cells were incubated at 37°C (30°C for NEB stable), 200 min-1 either in 5 ml (for a high copy ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1X Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), and 400 nM forward and reverse Fluidigm PCR primers in a 20 uL reaction volume ...