Labshake search
Citations for New England Biolabs :
4201 - 4250 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... coli (C2987H, NEB) and Plasmid Miniprep Kit (27106 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using NEB HiFi DNA Assembly Master Mix (NEB, #E2621), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... rRNA depletion was conducted using NEBNext rRNA depletion kit v2 (NEB, #E7400L) followed by end-repair using T4 PNK after purification of the rRNA depleted samples using Oligo Clean & Concentrator Kits (Zymo research ...
-
bioRxiv - Molecular Biology 2024Quote: ... The preparation of sequencing libraries for ribosome profiling was conducted via the NEBNext Multiplex Small RNA Library Prep kit for Illumina according to the manufacturer’s protocol (NEB, #E7300S). Pair-end sequencing reads of size 150 bp were produced for Ribo-seq on the Ilumina Hiseq X-ten system ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA library preparation was done using the NEBnext Ultra II DNA Library Prep Kit (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... sample was washed with 1x T4 ligase buffer (NEB) (2,500 xg ...
-
bioRxiv - Molecular Biology 2024Quote: ... to a final volume of 800 µl after washing it with 1x T4 ligase buffer (NEB) (2,500 xg ...
-
bioRxiv - Molecular Biology 2024Quote: ... The nuclei pellet was resuspended in buffer IV (160 µl annealed oligos, 1.2x T4 ligase buffer, 6,000 U T4 ligase, 1x protease inhibitors; NEB) to a final volume of 800 µl after washing it with 1x T4 ligase buffer (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... 850 U DpnII (NEB) and 35 µl rSAP (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA library preparation was done using the NEBnext Ultra II DNA Library Prep Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 35 µl rSAP (NEB) were added and sample was incubated for at least 8 h at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... were annealed (81 µl of each Oligo 100 µM, 1x T4 ligase buffer; NEB) at 98 °C for 5 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Buffer IIIb (3% Triton X-100, 1x T4 ligase buffer, 1x protease inhibitors; NEB, Sigma-Aldrich) was added to a final volume of 1 ml and sample was incubated for 15 min at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... Restriction free cloning was conducted using NEBuilder® HiFi DNA Assembly (NEB: E2621L). Isolation of plasmids and purification of PCR products were conducted by using commercially available kits from either Qiagen or Macherey-Nagel ...
-
bioRxiv - Cancer Biology 2024Quote: ... then split in 2 for PCR amplifications with either Minus or Plus primers using Q5 DNA Polymerase (New England Biolabs) with the following cycling conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... end-repair and A-Tailing were directly performed using the NEBNext UltraII DNA kit (New England Biolabs). A new custom universal Y-adapter based on the Illumina TruSeq sequences was designed to include a Unique Molecular Index (UMI ...
-
bioRxiv - Cancer Biology 2024Quote: ... and ligation (T4 DNA Ligase, NEB) and transformation (chemically competent NEB 5-alpha E ...
-
bioRxiv - Cancer Biology 2024Quote: ... fragments and destination plasmid were digested using the respective restriction enzymes (NEB) and ligation (T4 DNA Ligase ...
-
bioRxiv - Cancer Biology 2024Quote: ... Shipston and was N-terminally attached to an RFP (BKCa-DECRFP) using KpnI and BamHI restriction sites after PCR amplification (NEB Q5 High-Fidelity DNA-Polymerase, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cancer Biology 2024Quote: ... Shipston and was N-terminally attached to an RFP (BKCa-DECRFP) using KpnI and BamHI restriction sites after PCR amplification (NEB Q5 High-Fidelity DNA-Polymerase, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cancer Biology 2024Quote: ... the DNA fragments were purified from gel electrophoresis using the Monarch DNA gel extraction kit (NEB), fragments and destination plasmid were digested using the respective restriction enzymes (NEB ...
-
bioRxiv - Biophysics 2024Quote: ... 2.2.7+ (New England Biolabs Inc., Ipswich, MA) and SnapGene v ...
-
bioRxiv - Biochemistry 2024Quote: ... 2.5 μL 10 mM MnCl2 and 2 μL Lambda Protein Phosphatase (NEB). The dephosphorylation reaction was allowed to occur at 30 °C overnight ...
-
bioRxiv - Plant Biology 2024Quote: ... MpGDI2 (Mp6g05010) and MpNAC7 (Mp6g02620) by PCR using Phusion polymerase (NEB). Arabidopsis Bobber1 (At5g53400 ...
-
bioRxiv - Plant Biology 2024Quote: ... All obtained fragments were further incubated with dATP and Taq DNA polymerase (NEB) for 1 hour before cloned into the gateway compatible vector PCR8/GW/TOPO TA (Invitrogen ...
-
bioRxiv - Biophysics 2024Quote: ... into a pSGEM construct with five consecutive repeats of the myc tag (Lörinczi et al. 2015)) using NcoI and HindIII (New England Biolabs).
-
bioRxiv - Evolutionary Biology 2024Quote: ... Fully homogenized tissue was then used for DNA purification using the “Protocol for Extraction and Purification of Genomic DNA from Tissues” protocol for extraction and purification of genomic DNA from tissues in the Monarch® Genomic DNA Purification Kit (New England Biolabs T3010). DNA extract quality was assessed for quality (260:230 nm and 260:280 nm wavelengths ...
-
bioRxiv - Biochemistry 2024Quote: ... using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs, Frankfurt/Main, Germany). Pdxp-D14N was generated with the Platinum SuperFi II DNA Polymerase Mastermix according to mutagenesis protocol A provided by the manufacturer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... T201A and I490M (variants between NM_145913 and AK313788) by HiFi DNA Assembly Cloning (NEB) and site-directed mutagenesis ...
-
bioRxiv - Biochemistry 2024Quote: ... coli strains Nico21 (DE3) pLysS or BL21-codon plus (New England BioLabs) were used for overexpression ...
-
bioRxiv - Plant Biology 2024Quote: ... and 5′ phosphorylated with T4 Polynucleotide Kinase (NEB). The fragments were mixed with Golden Gate cloning adaptors (5′ adapter ...
-
bioRxiv - Physiology 2024Quote: ... coli (NEB, C3040H) according to the manufacture’s manual ...
-
bioRxiv - Biochemistry 2024Quote: ... and size-selected for 50-90 nt fragments for constructing a sequencing library using Universal miRNA Cloning Linker (NEB; S1315S) and the RNA-Seq library construction procedures described above ...
-
bioRxiv - Neuroscience 2024Quote: ... University of Oxford using NEBNext Ultra II Directional RNA Library Prep Kit (NEB, #E7760) and sequenced on NovaSeq6000_150PE (150 bp paired-end directional reads ...
-
bioRxiv - Molecular Biology 2024Quote: ... phosphatase treated with rSAP (NEB), and DNA cleaned ...
-
bioRxiv - Cell Biology 2024Quote: ... One µg total RNA/per isolate was used as input for generation of sequencing libraries using NEBNext®Ultra-TM RNA Library-Prep (Cat#E7770, NEB, Ipswich, USA) following manufacturer’s recommendations (Supplementary Methods) ...
-
bioRxiv - Genomics 2024Quote: ... All samples were then homogenized mechanically using a Monarch® Pestle Set single-use microtube pestle (New England Biolabs® Inc., Ipswich, MA, USA). Homogenization was performed both prior to ...
-
bioRxiv - Microbiology 2024Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Microbiology 2024Quote: ... and DNA polymerase (New England Biolabs), and then purified with Agencourt AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2024Quote: ... or restriction enzyme digestion followed by ligation with T4 DNA ligase (New England Biolabs). The pQCXIP-Empty plasmid was used as a negative control 42,44 ...
-
bioRxiv - Bioengineering 2024Quote: Samples were resuspended in 5 µl 1X NEBNext Cell Lysis Buffer of the NEBNext Single Cell/Low Input RNA Library Prep Kit (NEB, E6420). After 5 min incubation at RT ...
-
bioRxiv - Microbiology 2024Quote: Assays were performed using the PURExpress ΔRibosome (New England Biolabs) according to manufacturer instructions ...
-
bioRxiv - Immunology 2024Quote: ... and the cap1 structure was added for efficient translation and evading the cellular innate immune response (New England Biolabs, M2081 and M0366). Lipid-nanoparticle (LNP ...
-
bioRxiv - Immunology 2024Quote: ... The transcription products were then purified (New England Biolabs, T2050L) and the cap1 structure was added for efficient translation and evading the cellular innate immune response (New England Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... Q5 DNA polymerase (New England Biolabs) was used for all PCR reactions ...
-
bioRxiv - Biochemistry 2024Quote: ... The W75K substitution was introduced using Q5 site-directed mutagenesis kit (New England Biolabs, NEB). Substitutions L80E ...
-
bioRxiv - Biochemistry 2024Quote: ... The W75K substitution was introduced using Q5 site-directed mutagenesis kit (New England Biolabs, NEB). Substitutions L80E ...
-
bioRxiv - Biochemistry 2024Quote: ... OSCA1.2 pIRES2-mCherry vector and the BLD of OSCA3.1 were separately amplified by PCR using Q5 High-Fidelity 2X Master Mix (NEB), followed by fragment assembly using Gibson Assembly Master Mix (NEB) ...
-
bioRxiv - Cell Biology 2024Quote: ... zact sequence was amplified with primers containing attB sites (F: GGGGACAAGTTTGTACAAAAAAGCAGGCTC-CATGGATGAGGAAATCGCTG; R: GGGGACCACTTTGTACA-AGAAAGCTGGGTAGAAGCACTTCCTGTGGACGATG) using a high-fidelity polymerase (Phusion, NEB). To create a middle entry clone pME-zact ...
-
bioRxiv - Molecular Biology 2024Quote: ... Proteins were separated through SDS-PAGE and transferred to a PVDF membrane followed by incubation with anti-MBP monoclonal antibody (E8032S, NEB) and M2 Flag antibody (A8592 ...