Labshake search
Citations for New England Biolabs :
4101 - 4150 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and templates were digested using Dnp1 (New England Biolabs #R0176). Assembly reaction was performed at 1:2 vector ...
-
bioRxiv - Cell Biology 2024Quote: RNA encoding indicated HSP90B1 nascent chains were prepared from PCR amplified and purified DNA template containing a T7 promoter and carried out at 37°C for 2 hours using the HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using the RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... which was linearized with Esp3I enzyme (NEB #R0734L). The ligation was performed by adding an equal volume of NEB HiFi DNA Assembly Kit (#E5520S ...
-
bioRxiv - Cell Biology 2024Quote: ... For EndoH (NEB) treatment proteins from immunoprecipitated samples or from TCE were split into two aliquots and incubated in the presence or absence of 5mU of EndoH for 3 h at 37 °C according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmids encoding for TMX5-V5 WT and cysteine mutants were synthesized by Genscript in pUC57 and subcloned in pcDNA3.1(-) through restriction digestion of BamHI and HindIII (NEB) sites flanking the target sequence ...
-
bioRxiv - Cell Biology 2024Quote: ... was used to detect the point mutation in atg-9(bp564) and HinfI (New England BioLabs) was used to detect the point mutations in atg-16.1(gk668615[Q356*] ...
-
bioRxiv - Cell Biology 2024Quote: ... Annealed oligos were ligated with linearized pX330 at room temperature overnight with T4 ligase (NEB). Ligated products were transformed into DH5α ...
-
bioRxiv - Cancer Biology 2024Quote: ... iScript™ cDNA Synthesis Kit (Bio Rad, Cat. No. 1708891) was used for cDNA preparation and Luna® Universal qPCR Master Mix (NEB, Cat. No. M3003L) was used for subsequent qPCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepared by amplifying the sgID-BC region from 32μg of genomic DNA per mouse using unique dual-indexed primers and the Q5 Ultra II 2x Master Mix (New England Biolabs, M0544X). The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each desired sgRNA vector was modified from pll3-U6-sgRNA-Pgk-Cre vector via site-directed mutagenesis (New England Biolabs, E0554S). The generation of the barcode (BC ...
-
bioRxiv - Cancer Biology 2024Quote: ... Site-directed mutagenesis was performed using Q5 High-Fidelity DNA polymerase (New England Biolabs (NEB)) with primers generated using either QuikChange Primer Design (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... Site-directed mutagenesis was performed using Q5 High-Fidelity DNA polymerase (New England Biolabs (NEB)) with primers generated using either QuikChange Primer Design (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... and PCR was performed with OneTaq Standard 5X buffer and OneTaq Polymerase (New England Biolabs) using a 96-well Thermal Cycler (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Both miRNA-encoding plasmids and MG1 shuttle plasmids were digested using MLU-1 (NEB) and pre-miR-30-based cassette inserts were ligated individually into the MG1 shuttle vector ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were polyA-enriched and directional libraries were prepared using the NEBNext Ultra II Directional Library Prep Kit for Illumina (NEB). Libraries were PE150 sequenced on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... Adaptor-ligated DNA fragments of proper size were enriched with PCR reaction using Phusion High-Fidelity PCR Master Mix kit (NEB, M0531S) and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... The obtained DNAs were used for Adaptor Ligation using adaptors and enzymes provided in NEBNext Multiplex Oligos for Illumina (NEB#E7335) and following the kit’s reaction conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... via ligation-independent cloning with the NEBuilder® HiFi DNA Assembly Master Mix (NEB E2621S). Correct plasmid insert sequences were confirmed by Sanger sequencing (University of Utah DNA Sequencing Core ...
-
bioRxiv - Cell Biology 2024Quote: ... and reverse transcribed with M-MuLV Reverse Transcriptase (New England Biolabs, M0253) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR products were introduced in pMal-c2 (New England Biolabs) expression vector through FastCloning [34] ...
-
bioRxiv - Cell Biology 2024Quote: ... The recombinant proteins were then incubated with MBP amylose magnetic beads (New England Biolabs) for 1 h at 4°C and washed with 200 mM NaCl ...
-
bioRxiv - Cell Biology 2024Quote: ... The Color Protein Standard Broad Range (10–250 kDa) (New England BioLabs Inc.) was used as protein molecular weight ladder ...
-
bioRxiv - Cell Biology 2024Quote: ... Library preparation was carried out by the Edinburgh Clinical Research Facility from 500 ng of each RNA sample using the NEBNext Ultra II Directional RNA library kit with PolyA enrichment module (New England Biolabs). Libraries were assessed for quality and fragment size using the Agilent Bioanalyser ...
-
bioRxiv - Cell Biology 2024Quote: ... Coli (NEB C3013I). Fresh bacterial colonies were inoculated into LB media containing ampicillin and grown overnight at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Doxycycline inducible CCDC134 constructs were cloned by PCR amplification followed by Gibson assembly (New England Biolabs) into pLenti-TRE- rtta3G-BLAST.
-
bioRxiv - Cell Biology 2024Quote: ... For template plasmids the following fragments were joined by Gibson assembly (NEBuilder HiFi DNA assembly®, NEB): pUC19*EcorI (NEB) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed on the cDNA samples using Phusion polymerase (NEB). EGFP reactions used HF buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepared by NEBNext Ultra II DNA Library Preparation Kit protocol (NEB #E7645L) and analyzed by Agilent 4200 TapeStation ...
-
bioRxiv - Cancer Biology 2024Quote: ... and BamH1-HF (NEB, #R3136S) restriction enzymes followed by In-Fusion Snap Assembly (Takara ...
-
bioRxiv - Cancer Biology 2024Quote: ... Coli (NEB, #C3040H) and constructs were purified using the manufacture’s instruction of the MIDI-Prep system (Macherey-Nagel ...
-
bioRxiv - Cancer Biology 2024Quote: ... coli (catalog: C3019; New England Biolabs) were transformed with the Myc-DDK-tagged CPT1a transcript variant 1 (catalog ...
-
bioRxiv - Cell Biology 2024Quote: ... Size-selected DNA fragments were amplified using NEB unique multiplexed i5 and i7 primers (E6440) in a total reaction volume of 100 µl together with 2 U Phusion High-Fidelity DNA Polymerase (NEB) and in the presence of 0.2 mM dNTPs and 1X Phusion High-Fidelity buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... 400 U T4 DNA ligase (NEB), 1 mM ATP in 1X CutSmart buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... The NEB HiFi assembly kit (New England Biolabs) was used to clone the gene into a pET29b expression vector ...
-
bioRxiv - Developmental Biology 2024Quote: ... Chromatin was digested using 100U of HindIII (New England Biolabs, catalog no. R0104L), labeled with Biotin-14-dCTP (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... and then ligated using 50U of T4 DNA ligase (New England Biolabs, catalog no. M0202L). After reversing the cross-links ...
-
bioRxiv - Cell Biology 2024Quote: ... (R0176, New England Biolabs). E ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were prepared using the NEBNext Ultra II DNA Library Prep with Sample Purification Beads (NEB E7103S) following the manufacturer’s protocol with 5ng of starting DNA input ...
-
bioRxiv - Cancer Biology 2024Quote: ... 800ng RNA was used per sample as input for the RNA library preparation using NEBNext® rRNA Depletion Kit v2 (NEB, E7405L, USA) and NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... and NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB, E7760S, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each library was ligated with different indexes using NEBNext® Multiplex Oligos for Illumina (NEB, E6440S, USA) kit and amplified with 11 PCR cycles according to the instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Both PCR and qPCR were performed using Pfusion High-Fidelity Polymerase Master Mix (NEB) and full-length Solexa P3/5 primers ...
-
bioRxiv - Cell Biology 2024Quote: ... pFUW was linearized using NheI-HF (NEB R3131) and BamHI-HF (NEB R3136 ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmid DNA was linearized using AgeI restriction enzyme (New England Biolabs) then Poly A Tail was introduced using PCR (Table S11) ...
-
bioRxiv - Cell Biology 2024Quote: ... Ligation of pBluescript II KS (+) and ORF was performed using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: The deadenylase dead mutation (D1020A) in PAN2’s coding sequence was generated by site-directed mutagenesis (Q5 Site Directed Mutagenesis Kit from NEB E0554) with primer pairs 5’ GGTTTGAATAATGCCTTCAAACACATTAATATTAATGTC 3’ and 5’ ATGACCAACAAATACATTATTCAAACCATGACCAAC 3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... The vector backbone was also PCR-amplified and the three fragments were assembled with NEBuilder HiFi DNA assembly kit (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (New England Biolabs) and plasmid sequences confirmed with Sanger sequencing ...
-
bioRxiv - Systems Biology 2024Quote: ... and 25µL NEBNext High Fidelity 2X Master Mix (NEB #M0541S) and using the following PCR cycle settings ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... digested with EcoRV and HindIII (New England Biolabs), and cloned into compatible sites on the pGL4.10 vector (Promega) ...