Labshake search
Citations for New England Biolabs :
3601 - 3650 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... Plasmids from selected clones were digested with NdeI and BamHI (New England Biolabs) and the resulting insert gel purified as above and ligated into the modified pcAT7-Glo1 vector (a gift from Brenton Graveley ...
-
bioRxiv - Biochemistry 2024Quote: ... at NheI (NEB) and BamHI (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... DNA underwent repair utilizing the NEBNext Companion Module (New England Biolabs GmbH, GER). Subsequently ...
-
bioRxiv - Immunology 2024Quote: ... 10ng RNA was used to prepare libraries using Single Cell/Low Input RNA Library Prep Kit for Illumina (New England BioLabs). Libraries with different indexes were pooled and sequenced by an Illumina NovaSeq 6000 as paired-end reads extending 150 bases.
-
bioRxiv - Immunology 2024Quote: ... and poly-A enriched before library preparation using NEBNext Ultra II Directional RNA Library Prep Kit (NEB, USA). For each library ...
-
bioRxiv - Cell Biology 2024Quote: ... For endoglycosidase H (Endo H; P0702S, NE BioLabs) digestion experiments ...
-
bioRxiv - Cell Biology 2024Quote: ... and pCAH-mScarlet-C3 using KOD One PCR Master Mix (#KMM-101X5, TOYOBO) and NEBuilder HiFi DNA Assembly Master Mix (#E2621L, New England Biolabs), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Assemblies were transformed into 10-beta competent cells (NEB) and plated onto LB agar plates for overnight incubation at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... metaphase (metaphase to AO) or total mitotic (NEB to AO) durations were recorded ...
-
bioRxiv - Cell Biology 2024Quote: ... after ribosomal RNA (rRNA) depletion using an NEBNext rRNA Depletion Kit (New England Biolabs). Paired-end (2 × 36 bases ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs #T2010S). Reverse transcription was performed using iScript Reverse Transcription Supermix (BioRad #1708841 ...
-
bioRxiv - Cell Biology 2024Quote: ... or using NEB LunaScript RT SuperMix kit (NEB #E3010L). In both cases ...
-
bioRxiv - Cell Biology 2024Quote: ... and NEBnext Ultra II Directional RNA library prep kits (NEB #E7760L). Paired end 200 bp sequencing with additional reads for dual 8/8 indices plus the 11nt UMI after the i7 index was performed on an Illumina NovaSeq 6000 at the University of Chicago Genomics Facility.
-
bioRxiv - Developmental Biology 2024Quote: ... first using NEBuilder® HiFi DNA Assembly (New England Biolabs, E2621S) with the entpd5a(2.2):GFP construct ...
-
bioRxiv - Genetics 2024Quote: ... is a modification of this plasmid with TADa for ABE base editing derived from [11] and cloned using Gibson assembly NEBuilder HiFi DNA Assembly Master Mix (NEB Cat#E2621) and amplified using NEB 5-alpha F‘Iq Competent E ...
-
bioRxiv - Developmental Biology 2024Quote: ... The NEBuilder HiFi DNA Assembly Kit (NEB) was used for the construction of chimeric Pk1 and Pk2 mutants ...
-
bioRxiv - Genetics 2024Quote: ... and 4μl of the nuclease (NEB) along with 1μl of RNase A (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was extracted using Monarch® HMW DNA Extraction Kit for Cells & Blood (NEB, T3050), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... 20μl of 10X mung bean nuclease buffer (New England Bio Labs, NEB) and 4μl of the nuclease (NEB ...
-
bioRxiv - Genetics 2024Quote: ... The plasmid was digested with Hind III HF (NEB Biolabs) at 37°C for 1hr ...
-
bioRxiv - Genetics 2024Quote: ... The amplicons were obtained by amplifying PI 487260 DNA with primers located 37-138 bp outside of CNL/NL gene sequence using LongAmp® Hot Start Taq 2X Master Mix (New England Biolabs, Ipswich, Massachusetts, US) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB, Cat. No. E7490L), and the NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Physiology 2024Quote: ... The libraries for the Illumina sequencer (paired-end 150 bp) were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... downstream of the constitutive 35S promoter and upstream of the start codon of the GUS reporter using HiFi DNA assembly cloning kit (NEB E5520). Fragments of 35S promoter + vector backbone + GUS was amplified using forward primer ATGTTACGTCCTGTAGAAACCC and reverse primer GTCGACTCCAAATGAAATGAAC ...
-
bioRxiv - Plant Biology 2024Quote: ... The RbcL_D86H plasmid was created by KLD site-directed mutagenesis (New England Biolabs) of the P-67 cpDNA EcoRI 14 plasmid (Chlamydomonas Resource Centre).
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmids were isolated using Monarch (NEB) or PureYield (Promega ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli cells were incubated at 37°C (30°C for NEB stable), 200 min-1 either in 5 ml (for a high copy ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1X Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), and 400 nM forward and reverse Fluidigm PCR primers in a 20 uL reaction volume ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (NEB) was transformed with the final pET28a constructs ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 2 µl of Gel loading dye without SDS (NEB, Ipswich, MA) were added to each reaction ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Control plasmid was the PURExpress Control DHFR Plasmid (NEB, Ipswich, MA USA) with no fluorescent tag ...
-
bioRxiv - Synthetic Biology 2024Quote: ... transformed into NEB 10-beta electrocompetent cells (NEB C3020K), and extracted using the Qiagen Plasmid Maxi Kit (Qiagen 12162) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... then inserted the library cassette into the digested pMPRA1 backbone using the NEBuilder HiFi DNA Assembly kit (NEB E2621). This intermediate plasmid was purified with Kapa Pure Beads (Roche KK8002) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Amplification products were gel extracted using the Monarch® DNA Gel Extraction Kit (NEB T1020).
-
bioRxiv - Synthetic Biology 2024Quote: ... Both libraries were assembled through inverse PCR (iPCR) on the pET23-KOD-Exo-(Supplementary Information S1 Table S2) plasmid in Q5 High-Fidelity DNA Polymerase (NEB) reactions of 28 cycles following the manufacturer’s standard protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli cells following the recommended High Efficiency Transformation Protocol (C2987, New England Biolabs) described by the commercial strain provider ...
-
bioRxiv - Systems Biology 2024Quote: ... RNAs were extracted using Qiagen RNeasyPlus Mini kit and RNA library preparation performed using NEBNext Ultra II DirecMonal RNA Library prep Kit (NEB, Lynn, MA) following the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2024Quote: ... three sgRNAs for skp2 were designed and synthesized in vitro using HiScribe™ T7 High Yield RNA Synthesis Kit(NEB, E2040S). The Cas9-sgRNA ribonucleoprotein complex (RNP ...
-
bioRxiv - Developmental Biology 2024Quote: ... dsDNA donor molecules with ∼40 bp homology arms were prepared by PCR using Q5 DNA Polymerase (New England BioLabs) and purified using HighPrep PCR Clean-up beads (MagBio ...
-
bioRxiv - Genomics 2024Quote: ... using NEB KLD (NEB #M0554S).
-
bioRxiv - Genomics 2024Quote: Each cDNA library was built from 300 ng total RNA with ERCC spike-ins (Thermo cat. #4456740) using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB cat. #E7760), specifically the protocol for use with NEBNext Poly(A ...
-
bioRxiv - Genomics 2024Quote: ... specifically the protocol for use with NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB cat. #E7490). Ribosomal RNA was depleted from total input RNA using the NEBNext rRNA Depletion Kit (NEB cat ...
-
bioRxiv - Genetics 2024Quote: ... using the Gibson assembly method (NEB, #E5520S). The reaction products were electroporated into DH10β cells (ThermoFisher Scientific ...
-
bioRxiv - Genetics 2024Quote: ... Libraries were constructed with NEBNext® Ultra™ II FS DNA Library Prep Kit (New England Biolabs, Ipswich, MA).
-
bioRxiv - Genetics 2024Quote: ... the NsiI enzyme (New England BioLabs Inc. ®), and another with frequent cut ...
-
bioRxiv - Immunology 2024Quote: ... IdeZ (NEB) (1.5 hours ...
-
bioRxiv - Genetics 2024Quote: ... MSp508_MCS was digested with restriction enzymes AgeI-HF (NEB Cat#R3552S) and BstEII-HF (NEB Cat#R3162S) ...
-
bioRxiv - Immunology 2024Quote: ... and β-N-Acetylglucosaminidase S (NEB), or all three enzymes were performed overnight at 37 °C using 1 unit each of enzyme ...
-
bioRxiv - Genetics 2024Quote: Double-stranded RNA was in vitro transcribed from a PCR amplicon using T7 RNA Polymerase (New England BioLabs) (Extended Data Fig ...
-
bioRxiv - Genomics 2024Quote: ... PCR amplification with was Q5® High-Fidelity DNA Polymerase (New England Biolabs) with CFTR Exon 8 forward primer (5’-TTTCTGTTGGTGCTGATATTGCCTCAGGGTTCTTTGTGGTGT-3’ ...