Labshake search
Citations for New England Biolabs :
3401 - 3450 of 5111 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... reverse primer: ACCGCCTCC ACCGGATCTGAGTTACAAGGATGTTATATCATT) and the fragment was cloned into the vector using NEBuilder®HiFi DNA Assembly Master Mix (NEB, #E2621L) to generate a sequence encoding mNG-40L-TPM2 under control of a CMV promoter ...
-
bioRxiv - Physiology 2021Quote: ... and 72 °C for 5 min) using a Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) and primers containing the restriction sites of SpeI or BglII for subsequent subcloning (F ...
-
bioRxiv - Microbiology 2021Quote: ... PCRs were performed in 25 μL reaction volumes and contained 13 μL Q5® Hot Start High-Fidelity 2× Master Mix (New England Biolabs, US), 0.5 μM of each primer and 0.4 μL of 25 mg/mL BSA ...
-
bioRxiv - Molecular Biology 2022Quote: 16S rDNA inputs reacted with two self-looping oligonucleotides (SLOs) in NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs®) at 45°C for 2-3 hours ...
-
bioRxiv - Microbiology 2022Quote: ... The V4 hypervariable region of the 16S rRNA bacterial gene (515-806) was amplified using specific primers with the barcodes with Phusion High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, USA). PCR amplicons from each sample were pooled in equimolar amounts and purified using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Systems Biology 2022Quote: pAK-Tol2-TRE-JunDN-HA-T2A-GFP (pTRE-JunDN-HA-T2A-GFP) construct was assembled using Gibson assembly with NEBuilder HiFi DNA Assembly Master Mix (NEB, catalog # E2621) and inserted into a lentiviral pLVX-CMV empty backbone ...
-
bioRxiv - Microbiology 2019Quote: ... 22.5 μL elute was used for barcoding by mixing with the Blunt/TA Ligase Master Mix (New England Biolabs, Inc.; Catalog # M0367S) and Native Barcode (Oxford Nanopore Technologies Ltd. ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed in a final volume of 50 μL: 25 μL of Q5 polymerase master mix (New England Biolabs, MA, USA), 10 μL of GC enhancer buffer (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... PCRs were performed in 25.0 μL reactions containing: 12.5 μL of high-fidelity Taq DNA polymerase (Phusion® Master Mix, New England Biolabs, Ipswich, MA, USA), forward and reverse primers (both 0.4 μM) ...
-
bioRxiv - Microbiology 2021Quote: ... The components of the construct were joined using the Gibson Assembly method (NEBuilder HiFi DNA Assembly Master Mix, New England Biolabs, MA, USA), resulting in the dTomato gene under the control of several lengths of the promoter of lpmA (plasmids pRO311 ...
-
bioRxiv - Genetics 2020Quote: ... A length of 250 nt immediately preceding LdNT4 translation start was amplified from genomic DNA and both components were assembled via the Gibson Assembly method using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs, Ipswitch, MA).
-
bioRxiv - Microbiology 2020Quote: ... The Gibson Assembly method was then utilized to assemble the synthetic dsDNA fragments using the Gibson Assembly Master Mix (New England Biolabs, Ipswich, MA) (76) ...
-
bioRxiv - Immunology 2020Quote: ... The heavy and light chain PCR products were cloned in frame with seamless cloning using the NEBuilder® HiFi DNA Assembly Master Mix (NEB, UK) after linearizing the vectors with KpnI (5’ ...
-
bioRxiv - Genetics 2019Quote: ... EcoRV-digested amplicons encoding gRNA pairs were inserted into the vector in 3 separate Gibson assembly reactions (NEB Gibson Assembly Master Mix) according to manufacturer’s specifications ...
-
bioRxiv - Bioengineering 2021Quote: ... All the fragments were gel purified and assembled using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich, MA, USA). Complete AGG2069 plasmid sequence has been deposited to NCBI (Accession number ...
-
bioRxiv - Microbiology 2022Quote: ... and replaced it with the sequence encoding GFP in the pT7-RRV-NSP3-GFP constructed previously (12) by NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, cat. #E2621S). To construct expression vectors encoding HuNoV-VP1 (pCAG-HuNoV-VP1 ...
-
bioRxiv - Genomics 2022Quote: The bead-bound ligation products were amplified 8-13 cycles by PCR (Supplementary Information Table 5 for cycle recommendations according to starting cell number) using Phusion high-fidelity PCR master mix with HF buffer (New England Biolabs cat. #M0531L)
-
bioRxiv - Genomics 2022Quote: ... and the library was amplified 4 cycles by PCR using Phusion high-fidelity PCR master mix with HF buffer (New England Biolabs cat. #M0531L). Finally ...
-
bioRxiv - Genomics 2022Quote: ... the end-repaired DNA was ligated with 20 μl Barcode Adapter (ONT, cat# EXP-PBC096, blue cap) and Blunt/TA Ligase Master Mix (NEB, cat# M0367) for 10min at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... we amplified a 150 bp sequence using primers pGL3-CDC20_F and pGL3-CDC20_R (Phusion High-Fidelity PCR Master Mix, NEB M0531, Supplemental Table 5) that added restriction sites for SacI and XhoI to the 150 bp sequence ...
-
bioRxiv - Microbiology 2022Quote: ... A repair template plasmid carrying the ~1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard NATR cassette inserted between the two flanks ...
-
bioRxiv - Plant Biology 2022Quote: ... Constructs were assembled via using Gibson Assembly (Gibson et al., 2009) with a Gibson Assembly master mix (New England Biolabs; Ref.: E2611). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... Digested backbone and PCR amplified fragments were joined via seamless cloning (NEBuilder® HiFi DNA Assembly Master Mix, NEB, Cat. No. E2621S). Assembled plasmid was Sanger-sequenced to ensure correct assembly and reading frame ...
-
bioRxiv - Neuroscience 2022Quote: ... Transcriptomic profile of individual BAT samples was performed using commercial RNA-sequencing kits (NEBNext mRNA Library Prep Master Mix and NEBNext Multiplex Oligos for Illumina, New England Biolabs, Ipswich, MA) and adapted according to previous descriptions [22] ...
-
bioRxiv - Biophysics 2024Quote: ... Microexon 4 sequence (nucleotides 1258-1281) was deleted by PCR on the pBSK-nCPEB4 plasmid using Gibson Assembly® Master Mix (New England Biolabs, E2611S), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1pmol of each fragment were then assembled for 1h at 50°C using NEBuilder HiFi DNA Assembly master mix from the NEBuilder HiFi DNA Assembly Cloning Kit (NEB, ref E5520S). Reaction products were amplified in provided bacteria and purified using QIAprep Spin Miniprep Kit.
-
bioRxiv - Microbiology 2024Quote: ... A repair template plasmid carrying the ∼1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard HYGR cassette inserted between the two flanks ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A PCR master mix was employed with final concentrations of Standard ThermoPol buffer Mg-free (1x) (New England Biolabs, Ipswich MA, USA), dNTPs (0.2 mM each ...
-
bioRxiv - Genomics 2024Quote: The custom double stranded adapter containing primer-binding site was ligated by mixing 10 μl of NEB TA/Blunt Ligase Master Mix (cat #M0367, New England Biolabs MA, USA), 2 μl of duplex adapter (1 μM ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The PCR fragments and linearized pET28a-GSTmCherry vector were then subjected to homologous recombination using the NEBuilder® HiFi DNA Assembly Master Mix (NEB #E2621L) to obtain the ligated product ...
-
bioRxiv - Microbiology 2023Quote: ... End-repaired DNA was barcoded using the Native Barcoding Expansion kit (ONT, United Kingdom) and Blunt/TA Ligase Master Mix (New England Biolabs, United States). Barcoded samples were multiplexed and ligated to sequencing adaptor molecules in Adapter Mix II using the NEBNext Quick T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... full length CDS of TaSnRK1α was cloned into plant expression vector pCAMBIA1302 under the constitutive promoter CaMV:35S with the help of restriction site NcoI on both ends using Gibson assembly® master mix (NEB, USA). Primer details are provided in Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a codon optimized tdTomato with corresponding overhangs for integration using NEB HiFi DNA assembly (Gibson Assembly Master Mix NEB Cat #E2611). We first integrated the eGFP-IRES into a linearized backbone plasmid ...
-
bioRxiv - Biochemistry 2023Quote: ... These plasmids were constructed using the NEBuilder HiFi DNA assembly master mix as per the supplier’s recommendation (New England Biolabs GmbH, Frankfurt, Germany). The pLH52 and pLH53 plasmids were a gift from Dr ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the integrated sgRNA sequences were amplified and barcoded by two-step PCR using NEBNext Ultra II Q5 Master Mix (New England Biolabs, cat # M5044). The barcoded sgRNA samples were sequenced on an Illumina NextSeq500 to quantitate representation of each sgRNA in the Ub/Ubl pathway inhibitor-treated or non-treated control samples ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The pUdO#a was obtained by assembling four fragments (Table 1 and Figure S1) using the Gibson Assembly® Master Mix (New England Biolabs, E2611) according to the supplier’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplicons were purified by agarose gel extraction and inserted into pLVX-CMV-MCS-10N-mPGK-puro at EcoRI and NotI sites by using NEBuilder HiFi DNA Assembly Master Mix (NEB Cat# E2621L). At least 3 individual E.coli clones were picked for plasmid extraction and plasmids were sequenced with CMV-Forward and mPGK-Reverse primers (See Key resource table ...
-
bioRxiv - Neuroscience 2023Quote: ... Digested backbone and PCR amplified fragments were joined via seamless cloning (NEBuilder® HiFi DNA Assembly Master Mix, NEB, Cat. No. E2621S). Assembled plasmid was Sanger-sequenced to ensure correct assembly and reading frame ...
-
bioRxiv - Systems Biology 2023Quote: ... A 100 μl setup using 40 pmol of oDL00549 and 200 pmol each of oDL00122 and oDL00551 using the Q5 Master Mix (New England Biolabs, Ipswitch, MA) was run with an initial denaturation at 98 °C for 30 sec ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and both homology arms were ordered as gBlocks from Integrated DNA Technologies (IDT) and assembled (NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs (NEB)) ...
-
bioRxiv - Genomics 2023Quote: ... and cloned into Suntag-TET1CD Nhe1-HF/Not1-HF digested backbones with NEBuilder HiFi DNA assembly Master Mix (New England Biolabs Inc. E2621L). Following bacterial transformation into Stbl3 competent cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were amplified for 9 cycles for the hepatocyte libraries and 8 cycles for the liver organoid libraries using Phusion® High-Fidelity PCR Master Mix (NEB, M0531S) with the Nextflex primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... the dCas9-DNMT3A3L-P2A-EGFP region from plasmid pcDNA3.1-dCas9-Dnmt3a-Dnmt3l-P2A-eGFP (addgene# 128424) was amplified and inserted using the NEBuilder HiFi DNA Assembly Master Mix (NEB, Cat# M5520A) into the XLone-GFP backbone (addgene# 96930 ...
-
bioRxiv - Cancer Biology 2023Quote: sgRNA were directly amplified from genomic DNA in one step PCR using NEBNext® Ultra™ II Q5® Master Mix (NEB). Each PCR reaction was done with 10µg of genomic DNA in 100µL final volume ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmids were constructed using isothermal DNA assembly with 40-60 bp overhangs (NEBuilder HiFi DNA Assembly Master Mix, New England BioLabs, Ipswich, MA) and transformed into high-efficiency NEB 10-beta competent E ...
-
bioRxiv - Genomics 2024Quote: ... Up to 2.5 µg of genomic DNA was added to each 50 µL PCR reaction with 25 µL of NEBNext Ultra II Q5 master mix (NEB, Cat #M0544L), 1.25 µL of the 10 µM forward primer and 1.25 µL of the 10 µM reverse primer ...
-
bioRxiv - Genetics 2024Quote: ... Cloning was performed by Gibson Assembly of PCR amplified or commercially synthesized gene fragments (from Integrated DNA Technologies or Twist Bioscience) using NEBuilder Hifi Master Mix (NEB Cat# E262), and final plasmids sequence-verified by Sanger sequencing of the open reading frame and/or commercial whole-plasmid sequencing service provided by Primordium.
-
bioRxiv - Genomics 2024Quote: ... and amplified using ISOSDB412 IS-Seq Step1 and p7 primers for 13 cycles using Q5 Master Mix (New England Biolabs, Ipswich, MA). The products of this reaction were amplified with IS-Seq Step2 and p7 primers for 9 cycles using Q5 Master Mix and sequenced on a Novaseq 6000 at Novogene (Sacramento ...
-
bioRxiv - Bioengineering 2024Quote: ... Gibson assembly was performed by combining a part amplicon and linearized pEmpty in a 2:1 mass ratio in 2× NEB Gibson Assembly Master Mix (NEB, Cat# E2611S) and incubating at 50℃ for 2 hr before transformation ...
-
bioRxiv - Genetics 2024Quote: ... is a modification of this plasmid with TADa for ABE base editing derived from [11] and cloned using Gibson assembly NEBuilder HiFi DNA Assembly Master Mix (NEB Cat#E2621) and amplified using NEB 5-alpha F‘Iq Competent E ...